Incidental Mutation 'R6831:Alg3'
ID537874
Institutional Source Beutler Lab
Gene Symbol Alg3
Ensembl Gene ENSMUSG00000033809
Gene Nameasparagine-linked glycosylation 3 (alpha-1,3-mannosyltransferase)
SynonymsD16Ertd36e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R6831 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location20605374-20611735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20608747 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 25 (S25T)
Ref Sequence ENSEMBL: ENSMUSP00000156184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045918] [ENSMUST00000079600] [ENSMUST00000096197] [ENSMUST00000115522] [ENSMUST00000119224] [ENSMUST00000120394] [ENSMUST00000123774] [ENSMUST00000147867] [ENSMUST00000159780] [ENSMUST00000231362] [ENSMUST00000231386] [ENSMUST00000231387] [ENSMUST00000231471] [ENSMUST00000231531] [ENSMUST00000231749] [ENSMUST00000231904] [ENSMUST00000232319] [ENSMUST00000232451] [ENSMUST00000232458]
Predicted Effect probably benign
Transcript: ENSMUST00000045918
AA Change: S147T

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045272
Gene: ENSMUSG00000033809
AA Change: S147T

DomainStartEndE-ValueType
Pfam:ALG3 47 406 2.5e-145 PFAM
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079600
SMART Domains Protein: ENSMUSP00000078550
Gene: ENSMUSG00000115293

DomainStartEndE-ValueType
Pfam:Methyltransf_11 63 158 8.5e-8 PFAM
transmembrane domain 179 201 N/A INTRINSIC
Pfam:Peptidase_M13_N 233 618 1.2e-124 PFAM
Pfam:Peptidase_M13 677 880 1.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096197
SMART Domains Protein: ENSMUSP00000093911
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.3e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115522
SMART Domains Protein: ENSMUSP00000111184
Gene: ENSMUSG00000115219

DomainStartEndE-ValueType
Pfam:Methyltransf_18 58 176 5.9e-11 PFAM
Pfam:Methyltransf_31 58 208 1.5e-10 PFAM
Pfam:Methyltransf_25 62 169 1.4e-7 PFAM
Pfam:Methyltransf_12 63 171 4.5e-9 PFAM
Pfam:Methyltransf_11 63 173 2.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119224
SMART Domains Protein: ENSMUSP00000113772
Gene: ENSMUSG00000115219

DomainStartEndE-ValueType
Pfam:Methyltransf_18 58 166 1.9e-8 PFAM
Pfam:Methyltransf_25 62 142 1.7e-7 PFAM
Pfam:Methyltransf_11 63 164 5.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120394
SMART Domains Protein: ENSMUSP00000113475
Gene: ENSMUSG00000115293

DomainStartEndE-ValueType
Pfam:Methyltransf_18 58 163 1.2e-8 PFAM
Pfam:Methyltransf_11 63 163 1.7e-9 PFAM
transmembrane domain 208 230 N/A INTRINSIC
Pfam:Peptidase_M13_N 262 647 5e-109 PFAM
Pfam:Peptidase_M13 706 909 9.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123774
SMART Domains Protein: ENSMUSP00000123378
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127454
AA Change: S111T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120559
Gene: ENSMUSG00000033809
AA Change: S111T

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ALG3 51 118 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147867
Predicted Effect probably benign
Transcript: ENSMUST00000159780
SMART Domains Protein: ENSMUSP00000123727
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 5.5e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231362
Predicted Effect probably benign
Transcript: ENSMUST00000231386
AA Change: S147T

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231387
AA Change: S73T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231471
AA Change: S147T

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000231531
AA Change: S25T

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231749
AA Change: S73T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000231904
Predicted Effect probably benign
Transcript: ENSMUST00000232319
AA Change: S25T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably damaging
Transcript: ENSMUST00000232451
AA Change: S25T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000232458
AA Change: S73T

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALG3 family. The encoded protein catalyses the addition of the first dol-P-Man derived mannose in an alpha 1,3 linkage to Man5GlcNAc2-PP-Dol. Defects in this gene have been associated with congenital disorder of glycosylation type Id (CDG-Id) characterized by abnormal N-glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T G 10: 29,224,679 D349E probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Akr1cl C T 1: 65,014,672 probably null Het
Alcam A G 16: 52,309,901 Y29H probably benign Het
Amdhd1 T G 10: 93,527,256 L323F probably damaging Het
Apcdd1 C A 18: 62,950,126 Y342* probably null Het
Aqp9 T A 9: 71,162,420 probably benign Het
Arhgef5 A G 6: 43,280,999 T1326A probably damaging Het
B020004J07Rik T A 4: 101,836,897 Q263L probably benign Het
Cacna1a T C 8: 84,571,231 V1238A probably damaging Het
Cep128 T C 12: 91,266,974 D440G probably damaging Het
Dnah5 G C 15: 28,411,515 G3677R possibly damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
E330034G19Rik T C 14: 24,296,095 S25P probably benign Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fat3 C A 9: 16,376,551 V559L probably damaging Het
Fra10ac1 A T 19: 38,207,289 I162K probably benign Het
Glrx3 C T 7: 137,459,222 T195M possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gm9949 T A 18: 62,180,545 probably benign Het
Hbs1l T C 10: 21,341,868 S228P probably benign Het
Hmcn1 G A 1: 150,770,293 T718I probably benign Het
Igf1r T C 7: 68,207,319 S1010P possibly damaging Het
Inpp5d T A 1: 87,701,476 Y394* probably null Het
Itpr2 G A 6: 146,112,429 T2623M probably damaging Het
Kif21b T A 1: 136,144,758 C67* probably null Het
Lama1 T A 17: 67,756,754 C758S possibly damaging Het
Mdga1 T A 17: 29,887,516 K274* probably null Het
Neu2 G A 1: 87,596,733 G147R probably damaging Het
Nkx1-1 A T 5: 33,433,803 S58R unknown Het
Olfr677 A G 7: 105,056,879 D211G possibly damaging Het
Olfr698 A T 7: 106,752,571 N272K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T A 19: 5,160,795 I151F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pclo C T 5: 14,788,429 Q1417* probably null Het
Pkm G C 9: 59,675,115 M409I probably benign Het
Plbd2 T A 5: 120,493,066 K215N probably benign Het
Polk T C 13: 96,495,491 K245E possibly damaging Het
Prl T G 13: 27,059,547 I65S probably benign Het
Proser3 T C 7: 30,540,356 H441R probably benign Het
Psmb3 A G 11: 97,706,902 K98R probably benign Het
Ptpn20 T C 14: 33,632,925 V319A probably damaging Het
Ptprj A T 2: 90,460,647 Y397N probably damaging Het
Rp1 T C 1: 4,349,864 probably null Het
Sgsm1 T A 5: 113,280,380 Y314F probably damaging Het
Sh3pxd2a G A 19: 47,283,093 R244C probably damaging Het
Sspo G A 6: 48,484,833 V3466M possibly damaging Het
Syne2 T A 12: 75,966,794 F2921I probably benign Het
Trank1 T A 9: 111,377,899 M1700K probably benign Het
Trmt112 T A 19: 6,910,195 L4H probably damaging Het
Trmu A G 15: 85,895,006 T285A probably benign Het
Ttn A G 2: 76,771,502 probably null Het
Zc3hav1 A T 6: 38,332,168 M573K probably benign Het
Zcchc8 T C 5: 123,700,909 E522G probably damaging Het
Zfp354a T C 11: 51,070,554 S529P probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Alg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Alg3 APN 16 20607858 missense probably damaging 0.96
IGL01121:Alg3 APN 16 20610647 missense probably damaging 1.00
IGL02121:Alg3 APN 16 20606535 missense possibly damaging 0.55
R5487:Alg3 UTSW 16 20607780 missense probably damaging 1.00
R6183:Alg3 UTSW 16 20610641 missense probably benign 0.02
R6655:Alg3 UTSW 16 20609026 missense probably benign 0.22
R6890:Alg3 UTSW 16 20605986 missense possibly damaging 0.91
R7122:Alg3 UTSW 16 20607852 missense probably damaging 1.00
R7210:Alg3 UTSW 16 20605894 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTCATTGAAGAGCCGCAGTAC -3'
(R):5'- TCTGAAGGCATTGTGAAGGG -3'

Sequencing Primer
(F):5'- CATTGAAGAGCCGCAGTACAAAGATG -3'
(R):5'- TACCAGGCTGATAGTCCTGC -3'
Posted On2018-10-18