Incidental Mutation 'R6831:Apcdd1'
ID 537879
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock # R6831 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 62950126 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 342 (Y342*)
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably null
Transcript: ENSMUST00000096554
AA Change: Y342*
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: Y342*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163716
AA Change: Y342*
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: Y342*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T G 10: 29,224,679 D349E probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Akr1cl C T 1: 65,014,672 probably null Het
Alcam A G 16: 52,309,901 Y29H probably benign Het
Alg3 A T 16: 20,608,747 S25T probably damaging Het
Amdhd1 T G 10: 93,527,256 L323F probably damaging Het
Aqp9 T A 9: 71,162,420 probably benign Het
Arhgef5 A G 6: 43,280,999 T1326A probably damaging Het
B020004J07Rik T A 4: 101,836,897 Q263L probably benign Het
Cacna1a T C 8: 84,571,231 V1238A probably damaging Het
Cep128 T C 12: 91,266,974 D440G probably damaging Het
Dnah5 G C 15: 28,411,515 G3677R possibly damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
E330034G19Rik T C 14: 24,296,095 S25P probably benign Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fat3 C A 9: 16,376,551 V559L probably damaging Het
Fra10ac1 A T 19: 38,207,289 I162K probably benign Het
Glrx3 C T 7: 137,459,222 T195M possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gm9949 T A 18: 62,180,545 probably benign Het
Hbs1l T C 10: 21,341,868 S228P probably benign Het
Hmcn1 G A 1: 150,770,293 T718I probably benign Het
Igf1r T C 7: 68,207,319 S1010P possibly damaging Het
Inpp5d T A 1: 87,701,476 Y394* probably null Het
Itpr2 G A 6: 146,112,429 T2623M probably damaging Het
Kif21b T A 1: 136,144,758 C67* probably null Het
Lama1 T A 17: 67,756,754 C758S possibly damaging Het
Mdga1 T A 17: 29,887,516 K274* probably null Het
Neu2 G A 1: 87,596,733 G147R probably damaging Het
Nkx1-1 A T 5: 33,433,803 S58R unknown Het
Olfr677 A G 7: 105,056,879 D211G possibly damaging Het
Olfr698 A T 7: 106,752,571 N272K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T A 19: 5,160,795 I151F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pclo C T 5: 14,788,429 Q1417* probably null Het
Pkm G C 9: 59,675,115 M409I probably benign Het
Plbd2 T A 5: 120,493,066 K215N probably benign Het
Polk T C 13: 96,495,491 K245E possibly damaging Het
Prl T G 13: 27,059,547 I65S probably benign Het
Proser3 T C 7: 30,540,356 H441R probably benign Het
Psmb3 A G 11: 97,706,902 K98R probably benign Het
Ptpn20 T C 14: 33,632,925 V319A probably damaging Het
Ptprj A T 2: 90,460,647 Y397N probably damaging Het
Rp1 T C 1: 4,349,864 probably null Het
Sgsm1 T A 5: 113,280,380 Y314F probably damaging Het
Sh3pxd2a G A 19: 47,283,093 R244C probably damaging Het
Sspo G A 6: 48,484,833 V3466M possibly damaging Het
Syne2 T A 12: 75,966,794 F2921I probably benign Het
Trank1 T A 9: 111,377,899 M1700K probably benign Het
Trmt112 T A 19: 6,910,195 L4H probably damaging Het
Trmu A G 15: 85,895,006 T285A probably benign Het
Ttn A G 2: 76,771,502 probably null Het
Zc3hav1 A T 6: 38,332,168 M573K probably benign Het
Zcchc8 T C 5: 123,700,909 E522G probably damaging Het
Zfp354a T C 11: 51,070,554 S529P probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCGGTCAGATGAACACCAC -3'
(R):5'- AGACATGGCTCTCACTTCATCC -3'

Sequencing Primer
(F):5'- GGTCAGATGAACACCACCCTCC -3'
(R):5'- TTCATCCCCAGATCTCAAGCAG -3'
Posted On 2018-10-18