Incidental Mutation 'R6831:Pacs1'
ID537881
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Namephosphofurin acidic cluster sorting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6831 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5133688-5273119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5160795 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 151 (I151F)
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786]
Predicted Effect probably damaging
Transcript: ENSMUST00000025786
AA Change: I151F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: I151F

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T G 10: 29,224,679 D349E probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Akr1cl C T 1: 65,014,672 probably null Het
Alcam A G 16: 52,309,901 Y29H probably benign Het
Alg3 A T 16: 20,608,747 S25T probably damaging Het
Amdhd1 T G 10: 93,527,256 L323F probably damaging Het
Apcdd1 C A 18: 62,950,126 Y342* probably null Het
Aqp9 T A 9: 71,162,420 probably benign Het
Arhgef5 A G 6: 43,280,999 T1326A probably damaging Het
B020004J07Rik T A 4: 101,836,897 Q263L probably benign Het
Cacna1a T C 8: 84,571,231 V1238A probably damaging Het
Cep128 T C 12: 91,266,974 D440G probably damaging Het
Dnah5 G C 15: 28,411,515 G3677R possibly damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
E330034G19Rik T C 14: 24,296,095 S25P probably benign Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fat3 C A 9: 16,376,551 V559L probably damaging Het
Fra10ac1 A T 19: 38,207,289 I162K probably benign Het
Glrx3 C T 7: 137,459,222 T195M possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gm9949 T A 18: 62,180,545 probably benign Het
Hbs1l T C 10: 21,341,868 S228P probably benign Het
Hmcn1 G A 1: 150,770,293 T718I probably benign Het
Igf1r T C 7: 68,207,319 S1010P possibly damaging Het
Inpp5d T A 1: 87,701,476 Y394* probably null Het
Itpr2 G A 6: 146,112,429 T2623M probably damaging Het
Kif21b T A 1: 136,144,758 C67* probably null Het
Lama1 T A 17: 67,756,754 C758S possibly damaging Het
Mdga1 T A 17: 29,887,516 K274* probably null Het
Neu2 G A 1: 87,596,733 G147R probably damaging Het
Nkx1-1 A T 5: 33,433,803 S58R unknown Het
Olfr677 A G 7: 105,056,879 D211G possibly damaging Het
Olfr698 A T 7: 106,752,571 N272K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pclo C T 5: 14,788,429 Q1417* probably null Het
Pkm G C 9: 59,675,115 M409I probably benign Het
Plbd2 T A 5: 120,493,066 K215N probably benign Het
Polk T C 13: 96,495,491 K245E possibly damaging Het
Prl T G 13: 27,059,547 I65S probably benign Het
Proser3 T C 7: 30,540,356 H441R probably benign Het
Psmb3 A G 11: 97,706,902 K98R probably benign Het
Ptpn20 T C 14: 33,632,925 V319A probably damaging Het
Ptprj A T 2: 90,460,647 Y397N probably damaging Het
Rp1 T C 1: 4,349,864 probably null Het
Sgsm1 T A 5: 113,280,380 Y314F probably damaging Het
Sh3pxd2a G A 19: 47,283,093 R244C probably damaging Het
Sspo G A 6: 48,484,833 V3466M possibly damaging Het
Syne2 T A 12: 75,966,794 F2921I probably benign Het
Trank1 T A 9: 111,377,899 M1700K probably benign Het
Trmt112 T A 19: 6,910,195 L4H probably damaging Het
Trmu A G 15: 85,895,006 T285A probably benign Het
Ttn A G 2: 76,771,502 probably null Het
Zc3hav1 A T 6: 38,332,168 M573K probably benign Het
Zcchc8 T C 5: 123,700,909 E522G probably damaging Het
Zfp354a T C 11: 51,070,554 S529P probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5153698 missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5142632 missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5167972 missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5135005 missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5135110 splice site probably benign
Batavian UTSW 19 5156413 missense possibly damaging 0.71
chicory UTSW 19 5139297 missense probably benign 0.33
endive UTSW 19 5272583 nonsense probably null
Escarole UTSW 19 5156356 critical splice donor site probably null
frisee UTSW 19 5136791 missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5135121 splice site silent
R0369:Pacs1 UTSW 19 5141698 missense probably damaging 1.00
R0443:Pacs1 UTSW 19 5272583 nonsense probably null
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5135237 missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5152309 missense probably benign 0.00
R1689:Pacs1 UTSW 19 5272615 unclassified probably benign
R1842:Pacs1 UTSW 19 5155884 missense probably damaging 0.96
R1847:Pacs1 UTSW 19 5153714 missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5155759 missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5143833 nonsense probably null
R4630:Pacs1 UTSW 19 5156356 critical splice donor site probably null
R5029:Pacs1 UTSW 19 5142271 missense probably benign 0.03
R5198:Pacs1 UTSW 19 5139297 missense probably benign 0.33
R5223:Pacs1 UTSW 19 5145141 missense probably benign 0.00
R5464:Pacs1 UTSW 19 5147207 missense probably benign
R5695:Pacs1 UTSW 19 5136791 missense probably damaging 1.00
R6128:Pacs1 UTSW 19 5152372 splice site probably null
R6335:Pacs1 UTSW 19 5159977 missense probably damaging 1.00
R6802:Pacs1 UTSW 19 5152784 missense probably damaging 0.99
R7071:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5156413 missense possibly damaging 0.71
R7248:Pacs1 UTSW 19 5138975 missense probably damaging 1.00
R7576:Pacs1 UTSW 19 5145120 missense probably benign 0.09
R7682:Pacs1 UTSW 19 5152699 missense probably damaging 0.99
R7715:Pacs1 UTSW 19 5141681 missense probably benign 0.01
R7738:Pacs1 UTSW 19 5152350 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCAAACTGGGTTCTGGCTG -3'
(R):5'- ACCTCGTAGCCAAATTGTGTTG -3'

Sequencing Primer
(F):5'- GCTGTTTTTGGAGAATAAAGTCCTC -3'
(R):5'- GGTCATTGTCTGGTACATCAAAGCC -3'
Posted On2018-10-18