Incidental Mutation 'R6837:Colgalt2'
ID537888
Institutional Source Beutler Lab
Gene Symbol Colgalt2
Ensembl Gene ENSMUSG00000032649
Gene Namecollagen beta(1-O)galactosyltransferase 2
SynonymsGlt25d2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6837 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location152399830-152510695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152506828 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 477 (P477L)
Ref Sequence ENSEMBL: ENSMUSP00000037532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]
Predicted Effect probably damaging
Transcript: ENSMUST00000044311
AA Change: P477L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649
AA Change: P477L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 1.3e-20 PFAM
Pfam:Glyco_transf_25 340 525 5.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127586
SMART Domains Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 4.3e-17 PFAM
Pfam:Glyco_transf_25 340 466 3.2e-37 PFAM
Meta Mutation Damage Score 0.3743 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in Colgalt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Colgalt2 APN 1 152506878 missense probably damaging 0.98
IGL02900:Colgalt2 APN 1 152508730 missense probably damaging 0.99
R0280:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0282:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0328:Colgalt2 UTSW 1 152473108 missense probably damaging 1.00
R0409:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0412:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0485:Colgalt2 UTSW 1 152484871 missense probably damaging 1.00
R0518:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0519:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0556:Colgalt2 UTSW 1 152471813 splice site probably benign
R0605:Colgalt2 UTSW 1 152495792 splice site probably benign
R0628:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0972:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R1170:Colgalt2 UTSW 1 152503017 missense probably damaging 1.00
R1373:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R1452:Colgalt2 UTSW 1 152504153 missense probably damaging 1.00
R1456:Colgalt2 UTSW 1 152484904 missense probably damaging 1.00
R1544:Colgalt2 UTSW 1 152484952 missense probably damaging 1.00
R1707:Colgalt2 UTSW 1 152400363 missense probably damaging 1.00
R2285:Colgalt2 UTSW 1 152468550 missense probably benign 0.00
R2917:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R3916:Colgalt2 UTSW 1 152508611 nonsense probably null
R3917:Colgalt2 UTSW 1 152508611 nonsense probably null
R4250:Colgalt2 UTSW 1 152489887 missense probably benign 0.00
R4282:Colgalt2 UTSW 1 152468531 missense probably damaging 1.00
R4421:Colgalt2 UTSW 1 152485012 missense probably damaging 0.99
R4583:Colgalt2 UTSW 1 152506876 missense probably damaging 1.00
R4743:Colgalt2 UTSW 1 152400343 missense probably damaging 0.97
R4751:Colgalt2 UTSW 1 152489876 missense probably benign 0.34
R4832:Colgalt2 UTSW 1 152484998 missense possibly damaging 0.87
R4930:Colgalt2 UTSW 1 152499959 missense possibly damaging 0.92
R5319:Colgalt2 UTSW 1 152484869 missense possibly damaging 0.78
R5504:Colgalt2 UTSW 1 152400303 missense possibly damaging 0.88
R5916:Colgalt2 UTSW 1 152504122 missense probably damaging 1.00
R6006:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R6362:Colgalt2 UTSW 1 152471798 missense probably damaging 1.00
R7464:Colgalt2 UTSW 1 152504144 missense probably damaging 0.97
X0028:Colgalt2 UTSW 1 152471720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGGTGGTATGCATTAGGAAAAG -3'
(R):5'- ACCCAGGAGGCTAAGTTTGTG -3'

Sequencing Primer
(F):5'- GACACAAGAGTCCAGGCTTTAAAAC -3'
(R):5'- GCTAAGTTTGTGAACAGTATGTGACC -3'
Posted On2018-10-18