Mutagenetix > Incidental Mutations

Incidental Mutation 'R6837:Colgalt2'

537888

Institutional Source

Beutler Lab

Gene Symbol

Colgalt2

Ensembl Gene

ENSMUSG00000032649

Gene Name

collagen beta(1-O)galactosyltransferase 2

Synonyms

Glt25d2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R6837 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

152399830-152510695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 152506828 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 477 (P477L)

Ref Sequence

ENSEMBL: ENSMUSP00000037532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044311
AA Change: P477L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649
AA Change: P477L

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Glyco_tranf_2_4	61	181	1.3e-20	PFAM
Pfam:Glyco_transf_25	340	525	5.8e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127586

SMART Domains

Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Glyco_tranf_2_4	61	181	4.3e-17	PFAM
Pfam:Glyco_transf_25	340	466	3.2e-37	PFAM

Meta Mutation Damage Score

0.3743

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

98% (41/42)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap6	G	A	12: 53,141,262	E1820K	probably damaging	Het
Anxa8	A	T	14: 34,092,554	I116F	probably damaging	Het
Arid4a	A	G	12: 71,075,515	D890G	probably benign	Het
Aup1	C	T	6: 83,057,298	T396I	possibly damaging	Het
C2cd3	G	C	7: 100,448,746	E594Q	probably damaging	Het
D11Wsu47e	A	G	11: 113,688,613	H278R	possibly damaging	Het
Dennd3	G	A	15: 73,557,693	D20N	probably damaging	Het
Dpysl3	A	G	18: 43,437,882	I109T	probably benign	Het
Fas	A	T	19: 34,307,164	T24S	probably damaging	Het
Fras1	A	T	5: 96,726,973	I2332F	probably damaging	Het
Gm10267	T	C	18: 44,158,308	H32R	probably benign	Het
Hcfc2	A	T	10: 82,739,196	I230F	probably damaging	Het
Hdac9	T	C	12: 34,287,464	T673A	probably benign	Het
Herc2	T	G	7: 56,189,841	N3366K	possibly damaging	Het
Hhla1	T	C	15: 65,948,485	N139D	probably damaging	Het
Hip1r	A	G	5: 123,998,865	E632G	possibly damaging	Het
Kcnc2	A	G	10: 112,458,502	D98G	probably damaging	Het
Maip1	T	A	1: 57,415,732	*292K	probably null	Het
Map2	T	C	1: 66,414,572	F874L	probably damaging	Het
Myof	A	T	19: 37,922,956		probably null	Het
Notch2	A	G	3: 98,070,854		probably null	Het
Npy5r	T	A	8: 66,681,740	M134L	probably benign	Het
Ntsr2	T	A	12: 16,659,709	M225K	probably benign	Het
Nup153	G	A	13: 46,694,051	T634I	probably damaging	Het
Olfr583	T	A	7: 103,051,722	Y141*	probably null	Het
Pcsk5	T	C	19: 17,439,084	S1667G	probably benign	Het
Pex13	A	G	11: 23,649,527	I328T	possibly damaging	Het
Pkd2	T	G	5: 104,477,043	L235W	probably damaging	Het
Prune2	A	T	19: 17,178,928	D66V	probably damaging	Het
Rasal3	T	C	17: 32,403,070	N105S	probably benign	Het
Sla	A	T	15: 66,787,090	I144N	probably damaging	Het
Slc5a4b	A	T	10: 76,062,386	I498N	possibly damaging	Het
Snx14	C	T	9: 88,380,223	E872K	probably benign	Het
Stx16	G	A	2: 174,094,002	R242H	probably benign	Het
Tg	T	C	15: 66,696,135	F1296S	probably damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tmf1	G	A	6: 97,176,581	T177M	possibly damaging	Het
Tuba4a	T	C	1: 75,217,394	Q14R	probably damaging	Het
Vmn2r114	T	C	17: 23,310,202	M309V	probably benign	Het
Vps13c	C	T	9: 67,910,222	P1059S	probably benign	Het
Yars	T	A	4: 129,209,751	S298T	possibly damaging	Het

Other mutations in Colgalt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01472:Colgalt2	APN	1	152506878	missense	probably damaging	0.98
IGL02900:Colgalt2	APN	1	152508730	missense	probably damaging	0.99
R0280:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0282:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0328:Colgalt2	UTSW	1	152473108	missense	probably damaging	1.00
R0409:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0412:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0485:Colgalt2	UTSW	1	152484871	missense	probably damaging	1.00
R0518:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0519:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0556:Colgalt2	UTSW	1	152471813	splice site	probably benign
R0605:Colgalt2	UTSW	1	152495792	splice site	probably benign
R0628:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0972:Colgalt2	UTSW	1	152471744	missense	probably damaging	1.00
R1170:Colgalt2	UTSW	1	152503017	missense	probably damaging	1.00
R1373:Colgalt2	UTSW	1	152473161	missense	probably damaging	1.00
R1452:Colgalt2	UTSW	1	152504153	missense	probably damaging	1.00
R1456:Colgalt2	UTSW	1	152484904	missense	probably damaging	1.00
R1544:Colgalt2	UTSW	1	152484952	missense	probably damaging	1.00
R1707:Colgalt2	UTSW	1	152400363	missense	probably damaging	1.00
R2285:Colgalt2	UTSW	1	152468550	missense	probably benign	0.00
R2917:Colgalt2	UTSW	1	152471744	missense	probably damaging	1.00
R3916:Colgalt2	UTSW	1	152508611	nonsense	probably null
R3917:Colgalt2	UTSW	1	152508611	nonsense	probably null
R4250:Colgalt2	UTSW	1	152489887	missense	probably benign	0.00
R4282:Colgalt2	UTSW	1	152468531	missense	probably damaging	1.00
R4421:Colgalt2	UTSW	1	152485012	missense	probably damaging	0.99
R4583:Colgalt2	UTSW	1	152506876	missense	probably damaging	1.00
R4743:Colgalt2	UTSW	1	152400343	missense	probably damaging	0.97
R4751:Colgalt2	UTSW	1	152489876	missense	probably benign	0.34
R4832:Colgalt2	UTSW	1	152484998	missense	possibly damaging	0.87
R4930:Colgalt2	UTSW	1	152499959	missense	possibly damaging	0.92
R5319:Colgalt2	UTSW	1	152484869	missense	possibly damaging	0.78
R5504:Colgalt2	UTSW	1	152400303	missense	possibly damaging	0.88
R5916:Colgalt2	UTSW	1	152504122	missense	probably damaging	1.00
R6006:Colgalt2	UTSW	1	152473161	missense	probably damaging	1.00
R6362:Colgalt2	UTSW	1	152471798	missense	probably damaging	1.00
R7464:Colgalt2	UTSW	1	152504144	missense	probably damaging	0.97
R8462:Colgalt2	UTSW	1	152503072	missense	probably damaging	1.00
R8725:Colgalt2	UTSW	1	152484911	missense	probably damaging	0.99
R8727:Colgalt2	UTSW	1	152484911	missense	probably damaging	0.99
X0028:Colgalt2	UTSW	1	152471720	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTGGTGGTATGCATTAGGAAAAG -3'
(R):5'- ACCCAGGAGGCTAAGTTTGTG -3'

Sequencing Primer
(F):5'- GACACAAGAGTCCAGGCTTTAAAAC -3'
(R):5'- GCTAAGTTTGTGAACAGTATGTGACC -3'

Posted On

2018-10-18