Incidental Mutation 'R6837:Olfr583'
ID537898
Institutional Source Beutler Lab
Gene Symbol Olfr583
Ensembl Gene ENSMUSG00000073960
Gene Nameolfactory receptor 583
SynonymsMOR14-6, GA_x6K02T2PBJ9-5762668-5763618
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6837 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103051300-103052259 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 103051722 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 141 (Y141*)
Ref Sequence ENSEMBL: ENSMUSP00000095812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098211]
Predicted Effect probably null
Transcript: ENSMUST00000098211
AA Change: Y141*
SMART Domains Protein: ENSMUSP00000095812
Gene: ENSMUSG00000073960
AA Change: Y141*

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 9.1e-107 PFAM
Pfam:7TM_GPCR_Srsx 45 316 1.4e-5 PFAM
Pfam:7tm_1 50 301 9.6e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in Olfr583
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Olfr583 APN 7 103051375 missense probably benign 0.02
IGL02200:Olfr583 APN 7 103051793 missense probably benign
IGL02412:Olfr583 APN 7 103052152 missense probably benign 0.01
IGL02452:Olfr583 APN 7 103051931 missense probably benign 0.00
IGL02859:Olfr583 APN 7 103052138 missense probably benign 0.00
IGL03078:Olfr583 APN 7 103051829 missense probably damaging 1.00
R0675:Olfr583 UTSW 7 103051702 missense probably benign 0.22
R1474:Olfr583 UTSW 7 103052081 missense probably damaging 1.00
R1531:Olfr583 UTSW 7 103051588 missense probably benign 0.00
R1535:Olfr583 UTSW 7 103051369 missense probably benign 0.14
R1777:Olfr583 UTSW 7 103051376 missense probably benign 0.41
R1883:Olfr583 UTSW 7 103051982 missense probably benign 0.00
R1884:Olfr583 UTSW 7 103051982 missense probably benign 0.00
R2265:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2267:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2269:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2299:Olfr583 UTSW 7 103051582 missense probably damaging 0.99
R3802:Olfr583 UTSW 7 103052165 missense probably benign 0.05
R4239:Olfr583 UTSW 7 103051796 missense probably benign 0.17
R4426:Olfr583 UTSW 7 103051811 missense probably damaging 1.00
R5335:Olfr583 UTSW 7 103051535 missense probably damaging 1.00
R6048:Olfr583 UTSW 7 103051319 missense probably benign 0.00
R6270:Olfr583 UTSW 7 103051331 missense probably benign 0.27
R7257:Olfr583 UTSW 7 103051630 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CATAGCCTGCATGAACCTATGTAC -3'
(R):5'- TGCCCGAGTGTCTGAACATG -3'

Sequencing Primer
(F):5'- TGCCACTGACCTGGGTTTGAC -3'
(R):5'- CGAGTGTCTGAACATGCTAAC -3'
Posted On2018-10-18