Incidental Mutation 'R6837:Npy5r'
ID537899
Institutional Source Beutler Lab
Gene Symbol Npy5r
Ensembl Gene ENSMUSG00000044014
Gene Nameneuropeptide Y receptor Y5
SynonymsY5R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6837 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location66679965-66688128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66681740 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 134 (M134L)
Ref Sequence ENSEMBL: ENSMUSP00000148589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070810] [ENSMUST00000211920] [ENSMUST00000212563]
Predicted Effect probably benign
Transcript: ENSMUST00000070810
AA Change: M134L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000065157
Gene: ENSMUSG00000044014
AA Change: M134L

DomainStartEndE-ValueType
internal_repeat_1 15 36 1.53e-7 PROSPERO
internal_repeat_1 36 57 1.53e-7 PROSPERO
Pfam:7TM_GPCR_Srsx 73 253 1.9e-10 PFAM
Pfam:7tm_1 79 445 2.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211920
AA Change: M134L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000212563
AA Change: M134L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for neuropeptide Y and peptide YY. The encoded protein appears to be involved in regulating food intake, with defects in this gene being associated with eating disorders. Also, the encoded protein is involved in a pathway that protects neuroblastoma cells from chemotherapy-induced cell death, providing a possible therapeutic target against neuroblastoma. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show increased susceptibility to diet-induced obesity and a reduced orexigenic response to select agonists. Homozygotes for a reporter allele show mild late-onset obesity, increased adiposity, polyphagia, and exacerbated obesity parameters after chronic NPY infusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in Npy5r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Npy5r APN 8 66681866 missense possibly damaging 0.47
IGL02192:Npy5r APN 8 66681346 missense probably benign 0.02
oleo UTSW 8 66682041 nonsense probably null
roly-poly UTSW 8 66681540 frame shift probably null
R0395:Npy5r UTSW 8 66681973 missense probably benign 0.21
R1547:Npy5r UTSW 8 66681034 missense possibly damaging 0.52
R1616:Npy5r UTSW 8 66681400 missense probably damaging 1.00
R1906:Npy5r UTSW 8 66681473 missense probably damaging 1.00
R1965:Npy5r UTSW 8 66681277 missense probably benign
R2443:Npy5r UTSW 8 66681290 nonsense probably null
R4087:Npy5r UTSW 8 66682045 missense probably damaging 0.98
R4204:Npy5r UTSW 8 66682041 nonsense probably null
R4404:Npy5r UTSW 8 66681992 missense probably benign 0.01
R5427:Npy5r UTSW 8 66681020 missense probably damaging 0.98
R5530:Npy5r UTSW 8 66680860 missense probably benign 0.06
R5994:Npy5r UTSW 8 66682099 missense probably benign 0.06
R6041:Npy5r UTSW 8 66682023 missense possibly damaging 0.72
R6602:Npy5r UTSW 8 66681540 frame shift probably null
R7879:Npy5r UTSW 8 66681316 missense possibly damaging 0.92
R7962:Npy5r UTSW 8 66681316 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAAGCCCAGTGTCCAGACAG -3'
(R):5'- AGAGGCAGCGTAGACGACTTAC -3'

Sequencing Primer
(F):5'- CAGTGTCCAGACAGTAGCTATCAG -3'
(R):5'- GCGTAGACGACTTACAATACTTCCTG -3'
Posted On2018-10-18