Incidental Mutation 'R6837:Pex13'
ID537905
Institutional Source Beutler Lab
Gene Symbol Pex13
Ensembl Gene ENSMUSG00000020283
Gene Nameperoxisomal biogenesis factor 13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6837 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location23646479-23665959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23649527 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 328 (I328T)
Ref Sequence ENSEMBL: ENSMUSP00000020523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020523] [ENSMUST00000130811]
PDB Structure
Solution structure of the SH3 domain of mouse peroxisomal biogenesis factor 13 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020523
AA Change: I328T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020523
Gene: ENSMUSG00000020283
AA Change: I328T

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:Peroxin-13_N 101 256 3.6e-51 PFAM
SH3 277 337 1.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130811
Meta Mutation Damage Score 0.7077 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peroxisomal membrane protein that binds the type 1 peroxisomal targeting signal receptor via a SH3 domain located in the cytoplasm. Mutations and deficiencies in peroxisomal protein importing and peroxisome assembly lead to peroxisomal biogenesis disorders, an example of which is Zellweger syndrome. [provided by RefSeq, Oct 2008]
PHENOTYPE: Targeted disruption of this gene results in intrauterine growth retardation, hypotonia, aphagia, abnormal lamination of the cerebral cortex associated with a neuronal migration defect, liver steatosis, delayed differentiation of renal glomeruli, impairedperoxisome metabolism, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in Pex13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Pex13 APN 11 23656111 missense probably benign
Pitch UTSW 11 23655949 missense probably benign
yaw UTSW 11 23649527 missense possibly damaging 0.58
R0455:Pex13 UTSW 11 23655949 missense probably benign
R0671:Pex13 UTSW 11 23665831 missense possibly damaging 0.57
R1454:Pex13 UTSW 11 23649422 missense probably benign
R1738:Pex13 UTSW 11 23649458 missense probably benign
R1830:Pex13 UTSW 11 23655513 missense probably damaging 0.96
R2349:Pex13 UTSW 11 23655789 missense probably damaging 0.96
R4688:Pex13 UTSW 11 23655472 missense possibly damaging 0.69
R5094:Pex13 UTSW 11 23655441 missense probably benign 0.00
R5727:Pex13 UTSW 11 23655705 missense probably benign 0.02
R6360:Pex13 UTSW 11 23655690 missense probably benign 0.17
R6957:Pex13 UTSW 11 23655628 missense probably benign
R7167:Pex13 UTSW 11 23655472 missense possibly damaging 0.69
R7880:Pex13 UTSW 11 23649369 missense probably benign 0.26
R7898:Pex13 UTSW 11 23650929 critical splice donor site probably null
R7963:Pex13 UTSW 11 23649369 missense probably benign 0.26
R7981:Pex13 UTSW 11 23650929 critical splice donor site probably null
R8000:Pex13 UTSW 11 23655915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGGAAACCTTATTAGTTTCAAC -3'
(R):5'- ATTCCTTAACATAATCTCACTGTGAG -3'

Sequencing Primer
(F):5'- GTTTCAACAAAAACAGATTCAAAGGC -3'
(R):5'- CTTCCATTGATGATCGACAAGGC -3'
Posted On2018-10-18