Incidental Mutation 'R6837:D11Wsu47e'
ID537906
Institutional Source Beutler Lab
Gene Symbol D11Wsu47e
Ensembl Gene ENSMUSG00000041623
Gene NameDNA segment, Chr 11, Wayne State University 47, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6837 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location113684412-113694647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113688613 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 278 (H278R)
Ref Sequence ENSEMBL: ENSMUSP00000102232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042227] [ENSMUST00000106621] [ENSMUST00000120194] [ENSMUST00000123466] [ENSMUST00000153732]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042227
AA Change: H278R

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042025
Gene: ENSMUSG00000041623
AA Change: H278R

DomainStartEndE-ValueType
low complexity region 273 283 N/A INTRINSIC
low complexity region 491 510 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106621
AA Change: H278R

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102232
Gene: ENSMUSG00000041623
AA Change: H278R

DomainStartEndE-ValueType
low complexity region 273 283 N/A INTRINSIC
low complexity region 491 510 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120194
SMART Domains Protein: ENSMUSP00000113652
Gene: ENSMUSG00000041629

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 22 48 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
Pfam:FAM104 75 185 3.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123466
Predicted Effect probably benign
Transcript: ENSMUST00000153732
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in D11Wsu47e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:D11Wsu47e APN 11 113692470 missense probably benign 0.19
IGL01701:D11Wsu47e APN 11 113689101 missense probably benign 0.27
R0483:D11Wsu47e UTSW 11 113689195 missense possibly damaging 0.92
R0601:D11Wsu47e UTSW 11 113687886 missense probably benign 0.38
R1567:D11Wsu47e UTSW 11 113687902 missense probably damaging 0.99
R4834:D11Wsu47e UTSW 11 113688979 missense probably benign 0.03
R4923:D11Wsu47e UTSW 11 113688979 missense probably benign 0.03
R5194:D11Wsu47e UTSW 11 113688828 missense possibly damaging 0.83
R5779:D11Wsu47e UTSW 11 113687992 missense probably benign 0.02
R5815:D11Wsu47e UTSW 11 113687957 unclassified probably null
R6174:D11Wsu47e UTSW 11 113688975 missense possibly damaging 0.46
R6566:D11Wsu47e UTSW 11 113687998 missense probably damaging 0.96
R6974:D11Wsu47e UTSW 11 113687992 missense probably benign 0.02
R7497:D11Wsu47e UTSW 11 113692397 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGTGCCTCTTAGTGATCGTC -3'
(R):5'- AGGCTCTGATTCCCTGACTC -3'

Sequencing Primer
(F):5'- GTGATCGTCATTCTCCAAAGAGTG -3'
(R):5'- ACACGTTCCTAAGTTCGAGG -3'
Posted On2018-10-18