Incidental Mutation 'R6837:Ntsr2'
ID537907
Institutional Source Beutler Lab
Gene Symbol Ntsr2
Ensembl Gene ENSMUSG00000020591
Gene Nameneurotensin receptor 2
SynonymsNTRL, NT2R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6837 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location16653382-16660227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16659709 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 225 (M225K)
Ref Sequence ENSEMBL: ENSMUSP00000152592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111064] [ENSMUST00000220892] [ENSMUST00000221049] [ENSMUST00000221596]
Predicted Effect probably benign
Transcript: ENSMUST00000111064
AA Change: D330E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106693
Gene: ENSMUSG00000020591
AA Change: D330E

DomainStartEndE-ValueType
Pfam:7tm_1 49 358 4.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220892
AA Change: M270K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000221049
AA Change: M225K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000221596
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit abnormal thermal nociception. Mice homozygous for different knock-out allele exhibit increased prepulse inhibition and decreased accoustic startle response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in Ntsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Ntsr2 APN 12 16659848 missense probably damaging 0.97
IGL01973:Ntsr2 APN 12 16656774 missense probably benign 0.01
IGL02202:Ntsr2 APN 12 16653660 missense probably damaging 0.99
IGL02493:Ntsr2 APN 12 16658389 missense possibly damaging 0.90
IGL02837:Ntsr2 UTSW 12 16653875 missense probably damaging 0.99
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0381:Ntsr2 UTSW 12 16659718 nonsense probably null
R0437:Ntsr2 UTSW 12 16653695 missense probably damaging 1.00
R0666:Ntsr2 UTSW 12 16653980 missense probably benign 0.28
R0751:Ntsr2 UTSW 12 16654030 missense probably damaging 1.00
R1919:Ntsr2 UTSW 12 16654110 missense probably damaging 0.96
R2190:Ntsr2 UTSW 12 16654017 missense probably damaging 1.00
R5323:Ntsr2 UTSW 12 16659933 missense probably benign 0.00
R5358:Ntsr2 UTSW 12 16654082 missense probably damaging 1.00
R6282:Ntsr2 UTSW 12 16658425 missense probably damaging 1.00
R6358:Ntsr2 UTSW 12 16656768 missense probably benign 0.29
R6523:Ntsr2 UTSW 12 16656696 missense probably benign 0.05
RF017:Ntsr2 UTSW 12 16659765 missense probably damaging 0.99
X0064:Ntsr2 UTSW 12 16656757 missense probably damaging 1.00
Z1177:Ntsr2 UTSW 12 16653662 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CCAGGAAGTCACAGAAGCTG -3'
(R):5'- AAAGCCGGAAACTGTACGTAC -3'

Sequencing Primer
(F):5'- TCACAGAAGCTGGATAGAATGCATC -3'
(R):5'- CCGGAAACTGTACGTACTAGTAGTTG -3'
Posted On2018-10-18