Incidental Mutation 'R6837:Hhla1'
ID537914
Institutional Source Beutler Lab
Gene Symbol Hhla1
Ensembl Gene ENSMUSG00000072511
Gene NameHERV-H LTR-associating 1
SynonymsF930104E18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6837 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location65922443-65976804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65948485 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 139 (N139D)
Ref Sequence ENSEMBL: ENSMUSP00000098149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100584]
Predicted Effect probably damaging
Transcript: ENSMUST00000100584
AA Change: N139D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098149
Gene: ENSMUSG00000072511
AA Change: N139D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Meta Mutation Damage Score 0.2988 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in Hhla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Hhla1 APN 15 65941961 missense probably damaging 1.00
IGL02531:Hhla1 APN 15 65967407 splice site probably benign
IGL02609:Hhla1 APN 15 65930614 splice site probably benign
IGL02948:Hhla1 APN 15 65942693 missense probably damaging 1.00
IGL03063:Hhla1 APN 15 65941790 missense probably damaging 1.00
IGL03411:Hhla1 APN 15 65930229 critical splice donor site probably null
encroachment UTSW 15 65948485 missense probably damaging 1.00
trespass UTSW 15 65936382 nonsense probably null
P4717OSA:Hhla1 UTSW 15 65924001 missense probably damaging 0.99
R0277:Hhla1 UTSW 15 65948503 missense probably benign 0.01
R0323:Hhla1 UTSW 15 65948503 missense probably benign 0.01
R0492:Hhla1 UTSW 15 65936291 missense probably benign
R1546:Hhla1 UTSW 15 65933327 missense probably benign 0.10
R2039:Hhla1 UTSW 15 65936377 missense possibly damaging 0.75
R2112:Hhla1 UTSW 15 65936383 missense probably benign 0.00
R2405:Hhla1 UTSW 15 65936311 nonsense probably null
R4804:Hhla1 UTSW 15 65923099 missense probably benign 0.01
R5512:Hhla1 UTSW 15 65924016 missense probably benign 0.00
R5651:Hhla1 UTSW 15 65941814 missense probably damaging 1.00
R6012:Hhla1 UTSW 15 65948490 missense probably damaging 1.00
R6237:Hhla1 UTSW 15 65941797 missense probably damaging 1.00
R7506:Hhla1 UTSW 15 65936382 nonsense probably null
R7657:Hhla1 UTSW 15 65965459 missense probably damaging 0.99
Z1177:Hhla1 UTSW 15 65941775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGTCCTATTGCTCAAACAGT -3'
(R):5'- ACATCTTTTACCTTGCACATATTCAC -3'

Sequencing Primer
(F):5'- GGTCCTATTGCTCAAACAGTAGCAG -3'
(R):5'- GCTTTGTCTGGCTACAAACACAC -3'
Posted On2018-10-18