Incidental Mutation 'R6837:Rasal3'
ID537919
Institutional Source Beutler Lab
Gene Symbol Rasal3
Ensembl Gene ENSMUSG00000052142
Gene NameRAS protein activator like 3
SynonymsA430107D22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6837 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32390659-32403583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32403070 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 105 (N105S)
Ref Sequence ENSEMBL: ENSMUSP00000123141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063824] [ENSMUST00000135618] [ENSMUST00000136375] [ENSMUST00000137458]
Predicted Effect probably benign
Transcript: ENSMUST00000063824
AA Change: N127S

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142
AA Change: N127S

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 120 137 N/A INTRINSIC
PH 165 323 3.94e0 SMART
Blast:RasGAP 354 381 9e-8 BLAST
low complexity region 385 402 N/A INTRINSIC
RasGAP 433 755 2.03e-81 SMART
low complexity region 826 839 N/A INTRINSIC
coiled coil region 932 1013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135618
AA Change: N105S

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142
AA Change: N105S

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136375
AA Change: N105S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142
AA Change: N105S

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 7e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
Pfam:RasGAP 483 579 6.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137458
AA Change: N105S

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142
AA Change: N105S

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 119 140 N/A INTRINSIC
PH 167 325 3.94e0 SMART
Blast:RasGAP 356 383 9e-8 BLAST
low complexity region 387 404 N/A INTRINSIC
RasGAP 435 757 2.03e-81 SMART
low complexity region 828 841 N/A INTRINSIC
coiled coil region 934 1015 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras GTPase-activating proteins (RasGAP) family and encodes a protein with pleckstrin homology (PH), C2, and Ras GTPase-activation protein (RasGAP) domains. This protein is localized near or at the plasma membrane when expressed exogenously. Reduced expression of this gene in some cell lines resulted in increased levels of the active form of Ras (Ras-GTP), suggesting that this gene may play a role in negatively regulating the Ras signaling pathway. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced NT T cells in the liver, increased granulocytes in the bone marrow and decreased susceptibility to alpha-GalCer-induced liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in Rasal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Rasal3 APN 17 32397405 missense possibly damaging 0.89
IGL02291:Rasal3 APN 17 32393737 unclassified probably benign
IGL02346:Rasal3 APN 17 32399349 missense probably damaging 1.00
IGL02422:Rasal3 APN 17 32398973 missense probably benign 0.11
Beaten UTSW 17 32391344 missense probably benign 0.05
bent UTSW 17 32396781 missense probably damaging 1.00
bowed UTSW 17 32396790 missense probably damaging 1.00
kinked UTSW 17 32396350 nonsense probably null
R0057:Rasal3 UTSW 17 32391383 missense probably benign 0.00
R0133:Rasal3 UTSW 17 32403383 start codon destroyed probably null 0.89
R0180:Rasal3 UTSW 17 32399405 missense probably benign
R0403:Rasal3 UTSW 17 32392790 unclassified probably null
R0452:Rasal3 UTSW 17 32395817 splice site probably benign
R0600:Rasal3 UTSW 17 32393526 missense probably damaging 0.99
R0760:Rasal3 UTSW 17 32392172 missense probably benign 0.00
R1438:Rasal3 UTSW 17 32393535 unclassified probably null
R1669:Rasal3 UTSW 17 32403098 missense possibly damaging 0.81
R1914:Rasal3 UTSW 17 32396350 nonsense probably null
R1928:Rasal3 UTSW 17 32397353 missense probably damaging 1.00
R2002:Rasal3 UTSW 17 32393611 missense probably damaging 1.00
R3053:Rasal3 UTSW 17 32403439 missense probably benign 0.03
R3770:Rasal3 UTSW 17 32392151 missense probably damaging 0.99
R3870:Rasal3 UTSW 17 32393548 missense possibly damaging 0.94
R4491:Rasal3 UTSW 17 32391385 missense probably damaging 0.99
R4783:Rasal3 UTSW 17 32396781 missense probably damaging 1.00
R4788:Rasal3 UTSW 17 32399338 missense probably benign 0.00
R4903:Rasal3 UTSW 17 32397383 missense probably damaging 1.00
R5185:Rasal3 UTSW 17 32396790 missense probably damaging 1.00
R5372:Rasal3 UTSW 17 32391344 missense probably benign 0.05
R5433:Rasal3 UTSW 17 32393601 missense probably benign 0.00
R5472:Rasal3 UTSW 17 32396669 missense probably damaging 1.00
R5920:Rasal3 UTSW 17 32395169 missense probably damaging 1.00
R6436:Rasal3 UTSW 17 32397504 missense probably damaging 1.00
R7047:Rasal3 UTSW 17 32396484 missense probably damaging 1.00
R7109:Rasal3 UTSW 17 32392709 missense probably damaging 1.00
R7179:Rasal3 UTSW 17 32392417 missense probably damaging 0.99
R7571:Rasal3 UTSW 17 32395861 missense possibly damaging 0.76
R7768:Rasal3 UTSW 17 32396793 missense probably damaging 0.96
R7874:Rasal3 UTSW 17 32396707 missense possibly damaging 0.75
R7957:Rasal3 UTSW 17 32396707 missense possibly damaging 0.75
RF004:Rasal3 UTSW 17 32391107 missense probably damaging 1.00
X0027:Rasal3 UTSW 17 32391219 missense probably damaging 1.00
X0027:Rasal3 UTSW 17 32392526 missense probably benign 0.00
X0065:Rasal3 UTSW 17 32403286 missense probably damaging 1.00
Z1177:Rasal3 UTSW 17 32399310 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTTCTCAGCTGAACCCCAG -3'
(R):5'- AAAAGGCTGCTGGAGGGTTC -3'

Sequencing Primer
(F):5'- ACGGGTCCTGCCAGTCTTC -3'
(R):5'- CTTTGCAGGCTGGGGAAG -3'
Posted On2018-10-18