Incidental Mutation 'R6837:Dpysl3'
ID537920
Institutional Source Beutler Lab
Gene Symbol Dpysl3
Ensembl Gene ENSMUSG00000024501
Gene Namedihydropyrimidinase-like 3
SynonymsTUC4, Ulip, Ulip1, CRMP-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R6837 (G1)
Quality Score193.009
Status Validated
Chromosome18
Chromosomal Location43320979-43438286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43437882 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 109 (I109T)
Ref Sequence ENSEMBL: ENSMUSP00000112928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121805]
Predicted Effect probably benign
Transcript: ENSMUST00000121805
AA Change: I109T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112928
Gene: ENSMUSG00000024501
AA Change: I109T

DomainStartEndE-ValueType
low complexity region 85 102 N/A INTRINSIC
Pfam:Amidohydro_1 177 566 1.4e-41 PFAM
Pfam:Amidohydro_3 481 566 1.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the TUC (TOAD-64/Ulip/CRMP) family of proteins. Members of this family are phosphoproteins that function in axonal guidance and neuronal differentiation during development and regeneration of the nervous system. A mutation in the human gene is associated with amyotrophic lateral sclerosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired axon extension, abnormal neuron growth cones morphology and impaired anterograde transportation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in Dpysl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Dpysl3 APN 18 43358300 missense probably damaging 1.00
IGL02533:Dpysl3 APN 18 43325794 missense probably benign 0.00
IGL02632:Dpysl3 APN 18 43393025 missense possibly damaging 0.50
IGL03111:Dpysl3 APN 18 43329845 missense probably damaging 1.00
IGL03138:Dpysl3 UTSW 18 43325794 missense probably benign 0.00
R0001:Dpysl3 UTSW 18 43358375 missense possibly damaging 0.93
R0062:Dpysl3 UTSW 18 43333876 splice site probably null
R0062:Dpysl3 UTSW 18 43333876 splice site probably null
R0656:Dpysl3 UTSW 18 43438071 missense possibly damaging 0.65
R1522:Dpysl3 UTSW 18 43363557 missense probably damaging 1.00
R1694:Dpysl3 UTSW 18 43328374 missense possibly damaging 0.94
R1764:Dpysl3 UTSW 18 43363518 missense probably damaging 1.00
R1822:Dpysl3 UTSW 18 43342328 missense probably benign 0.07
R1880:Dpysl3 UTSW 18 43329874 splice site probably null
R1907:Dpysl3 UTSW 18 43438128 missense probably damaging 1.00
R1925:Dpysl3 UTSW 18 43332931 missense probably damaging 1.00
R2248:Dpysl3 UTSW 18 43358293 missense possibly damaging 0.56
R3434:Dpysl3 UTSW 18 43361061 missense probably benign 0.01
R4575:Dpysl3 UTSW 18 43342247 missense probably damaging 1.00
R4778:Dpysl3 UTSW 18 43354802 missense probably benign 0.06
R4780:Dpysl3 UTSW 18 43354802 missense probably benign 0.06
R4858:Dpysl3 UTSW 18 43334014 missense probably damaging 0.96
R4987:Dpysl3 UTSW 18 43328427 missense probably benign 0.00
R5151:Dpysl3 UTSW 18 43438080 missense probably benign 0.00
R5152:Dpysl3 UTSW 18 43438080 missense probably benign 0.00
R5229:Dpysl3 UTSW 18 43332951 missense probably damaging 1.00
R5373:Dpysl3 UTSW 18 43361036 missense probably damaging 1.00
R5374:Dpysl3 UTSW 18 43361036 missense probably damaging 1.00
R5383:Dpysl3 UTSW 18 43438038 missense probably damaging 1.00
R6014:Dpysl3 UTSW 18 43361067 missense probably damaging 1.00
R6958:Dpysl3 UTSW 18 43438002 missense probably benign
R6991:Dpysl3 UTSW 18 43353891 missense probably damaging 1.00
R7087:Dpysl3 UTSW 18 43363530 missense probably damaging 1.00
R7196:Dpysl3 UTSW 18 43329845 missense probably damaging 1.00
R7223:Dpysl3 UTSW 18 43438042 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGGGGACACGTGAGAACTTG -3'
(R):5'- CAAGACGTTGGATTTTGATGCCC -3'

Sequencing Primer
(F):5'- ACGTGAGAACTTGGGCCCTTG -3'
(R):5'- CTGAGTGTGGGACAGCG -3'
Posted On2018-10-18