Incidental Mutation 'R6838:Map4k4'
ID537926
Institutional Source Beutler Lab
Gene Symbol Map4k4
Ensembl Gene ENSMUSG00000026074
Gene Namemitogen-activated protein kinase kinase kinase kinase 4
Synonyms9430080K19Rik, Nik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6838 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location39900913-40026310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39976722 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 108 (C108S)
Ref Sequence ENSEMBL: ENSMUSP00000141613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163854] [ENSMUST00000168431] [ENSMUST00000191761] [ENSMUST00000192509] [ENSMUST00000193682] [ENSMUST00000195259] [ENSMUST00000195636] [ENSMUST00000195860]
Predicted Effect unknown
Transcript: ENSMUST00000163854
AA Change: C108S
SMART Domains Protein: ENSMUSP00000126961
Gene: ENSMUSG00000026074
AA Change: C108S

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168431
AA Change: C108S
SMART Domains Protein: ENSMUSP00000129796
Gene: ENSMUSG00000026074
AA Change: C108S

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191761
AA Change: C108S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141332
Gene: ENSMUSG00000026074
AA Change: C108S

DomainStartEndE-ValueType
S_TKc 25 289 3.4e-97 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192509
AA Change: C108S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141665
Gene: ENSMUSG00000026074
AA Change: C108S

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000193682
AA Change: C108S
SMART Domains Protein: ENSMUSP00000141862
Gene: ENSMUSG00000026074
AA Change: C108S

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 590 616 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 680 706 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
CNH 903 1201 2.76e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195259
AA Change: C108S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142056
Gene: ENSMUSG00000026074
AA Change: C108S

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 811 824 N/A INTRINSIC
low complexity region 839 849 N/A INTRINSIC
CNH 890 1188 2.76e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195636
AA Change: C108S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141613
Gene: ENSMUSG00000026074
AA Change: C108S

DomainStartEndE-ValueType
S_TKc 25 289 3.4e-97 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 836 865 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
CNH 954 1252 1.4e-129 SMART
Predicted Effect unknown
Transcript: ENSMUST00000195860
AA Change: C108S
SMART Domains Protein: ENSMUSP00000141400
Gene: ENSMUSG00000026074
AA Change: C108S

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos around day E9.5-10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Map4k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Map4k4 APN 1 40004816 missense probably damaging 0.99
IGL00417:Map4k4 APN 1 40014532 missense possibly damaging 0.92
IGL00516:Map4k4 APN 1 40014602 missense probably damaging 1.00
IGL01545:Map4k4 APN 1 40014229 splice site probably benign
IGL02092:Map4k4 APN 1 39986783 missense probably benign 0.12
IGL02092:Map4k4 APN 1 40024348 missense probably damaging 1.00
IGL02570:Map4k4 APN 1 39980579 missense probably benign 0.06
IGL02626:Map4k4 APN 1 40014097 splice site probably benign
IGL02993:Map4k4 APN 1 40014188 missense probably damaging 0.98
IGL03178:Map4k4 APN 1 39986693 missense possibly damaging 0.63
tank UTSW 1 40004864 missense possibly damaging 0.93
IGL02835:Map4k4 UTSW 1 40010600 missense probably damaging 0.99
R0496:Map4k4 UTSW 1 40006822 missense probably damaging 0.99
R0498:Map4k4 UTSW 1 39990178 missense probably benign 0.22
R0588:Map4k4 UTSW 1 40004864 missense possibly damaging 0.93
R0674:Map4k4 UTSW 1 40003815 missense probably damaging 1.00
R1205:Map4k4 UTSW 1 40003844 missense probably damaging 1.00
R1349:Map4k4 UTSW 1 40021159 missense probably damaging 1.00
R1615:Map4k4 UTSW 1 40006830 splice site probably benign
R1763:Map4k4 UTSW 1 40000757 splice site probably benign
R1800:Map4k4 UTSW 1 40023460 missense probably damaging 1.00
R1893:Map4k4 UTSW 1 40001557 missense probably benign 0.08
R2411:Map4k4 UTSW 1 40007496 missense probably damaging 0.96
R2851:Map4k4 UTSW 1 40000755 splice site probably benign
R2852:Map4k4 UTSW 1 40000755 splice site probably benign
R2987:Map4k4 UTSW 1 39986765 missense probably damaging 1.00
R3087:Map4k4 UTSW 1 40021082 critical splice acceptor site probably null
R3688:Map4k4 UTSW 1 39985171 splice site probably null
R4075:Map4k4 UTSW 1 40023462 missense probably damaging 0.96
R4304:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R4564:Map4k4 UTSW 1 39988975 missense probably damaging 1.00
R4569:Map4k4 UTSW 1 40000538 missense probably damaging 1.00
R4613:Map4k4 UTSW 1 40017191 missense probably benign 0.05
R4715:Map4k4 UTSW 1 40019564 missense probably damaging 1.00
R4788:Map4k4 UTSW 1 40003916 missense probably benign 0.01
R4926:Map4k4 UTSW 1 40017225 missense probably damaging 1.00
R4943:Map4k4 UTSW 1 40019594 missense probably damaging 0.99
R5033:Map4k4 UTSW 1 40007502 missense probably damaging 0.99
R5177:Map4k4 UTSW 1 39986762 missense probably damaging 1.00
R5297:Map4k4 UTSW 1 39962217 missense probably damaging 1.00
R5844:Map4k4 UTSW 1 39999876 splice site probably benign
R5952:Map4k4 UTSW 1 39999922 unclassified probably benign
R6111:Map4k4 UTSW 1 40011662 missense probably benign 0.00
R6125:Map4k4 UTSW 1 40003965 missense possibly damaging 0.77
R6927:Map4k4 UTSW 1 40011682 missense probably benign 0.00
R7008:Map4k4 UTSW 1 39988971 missense probably benign 0.44
R7164:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R7195:Map4k4 UTSW 1 40019669 missense possibly damaging 0.93
R7352:Map4k4 UTSW 1 39962227 missense unknown
R7589:Map4k4 UTSW 1 40021091 nonsense probably null
R7816:Map4k4 UTSW 1 40014208 missense possibly damaging 0.53
R7869:Map4k4 UTSW 1 39974044 missense unknown
R8013:Map4k4 UTSW 1 39962212 missense unknown
R8145:Map4k4 UTSW 1 40000534 missense
R8154:Map4k4 UTSW 1 40021142 nonsense probably null
R8254:Map4k4 UTSW 1 40006675 missense probably damaging 0.99
R8266:Map4k4 UTSW 1 40011653 missense possibly damaging 0.53
R8375:Map4k4 UTSW 1 40024641 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGAGTTAGCACCCAGGCATG -3'
(R):5'- TGCTTGGCTACCAAAAGAGAC -3'

Sequencing Primer
(F):5'- CGGCAGGGAATATACTTTTATAAAGC -3'
(R):5'- TGGCTACCAAAAGAGACAATTATCTC -3'
Posted On2018-10-18