Incidental Mutation 'R6838:Iars2'
ID537932
Institutional Source Beutler Lab
Gene Symbol Iars2
Ensembl Gene ENSMUSG00000026618
Gene Nameisoleucine-tRNA synthetase 2, mitochondrial
Synonyms2010002H18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6838 (G1)
Quality Score156.008
Status Validated
Chromosome1
Chromosomal Location185284726-185329396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 185329145 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 48 (A48V)
Ref Sequence ENSEMBL: ENSMUSP00000106603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027916] [ENSMUST00000027921] [ENSMUST00000110965] [ENSMUST00000110974] [ENSMUST00000110975] [ENSMUST00000151769] [ENSMUST00000210277]
Predicted Effect probably benign
Transcript: ENSMUST00000027916
SMART Domains Protein: ENSMUSP00000027916
Gene: ENSMUSG00000026617

DomainStartEndE-ValueType
Pfam:Inositol_P 8 303 7.1e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000027921
AA Change: A48V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027921
Gene: ENSMUSG00000026618
AA Change: A48V

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:tRNA-synt_1 87 712 3.6e-172 PFAM
Pfam:tRNA-synt_1g 112 268 7e-15 PFAM
Pfam:tRNA-synt_1_2 334 462 3.8e-7 PFAM
Pfam:Anticodon_1 756 920 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110965
SMART Domains Protein: ENSMUSP00000106590
Gene: ENSMUSG00000026617

DomainStartEndE-ValueType
Pfam:Inositol_P 1 248 2.8e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110974
AA Change: A48V

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106601
Gene: ENSMUSG00000026618
AA Change: A48V

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:tRNA-synt_1 87 552 2e-130 PFAM
Pfam:tRNA-synt_1g 113 269 2.2e-17 PFAM
Pfam:tRNA-synt_1_2 293 462 9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110975
AA Change: A48V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106603
Gene: ENSMUSG00000026618
AA Change: A48V

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:tRNA-synt_1 87 712 1.2e-171 PFAM
Pfam:tRNA-synt_1g 113 269 3.4e-17 PFAM
Pfam:tRNA-synt_1_2 293 462 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151769
SMART Domains Protein: ENSMUSP00000117122
Gene: ENSMUSG00000026617

DomainStartEndE-ValueType
Pfam:Inositol_P 8 83 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210277
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of isoleucine-tRNA synthetase exist, a cytoplasmic form and a mitochondrial form. This gene encodes the mitochondrial isoleucine-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Iars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Iars2 APN 1 185315954 missense probably benign 0.00
IGL00906:Iars2 APN 1 185296403 splice site probably benign
IGL01287:Iars2 APN 1 185296428 missense possibly damaging 0.90
IGL01814:Iars2 APN 1 185302775 nonsense probably null
IGL02016:Iars2 APN 1 185303306 missense probably damaging 0.99
IGL02995:Iars2 APN 1 185303301 missense probably benign
IGL03002:Iars2 APN 1 185322816 splice site probably null
IGL03248:Iars2 APN 1 185291432 unclassified probably benign
R0304:Iars2 UTSW 1 185287156 missense possibly damaging 0.77
R0711:Iars2 UTSW 1 185322388 splice site probably benign
R0783:Iars2 UTSW 1 185320874 missense probably damaging 1.00
R0990:Iars2 UTSW 1 185318627 missense probably damaging 1.00
R1867:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1868:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1957:Iars2 UTSW 1 185295671 missense possibly damaging 0.89
R2378:Iars2 UTSW 1 185327721 missense probably damaging 1.00
R3784:Iars2 UTSW 1 185287131 missense probably benign 0.17
R4061:Iars2 UTSW 1 185303386 missense possibly damaging 0.85
R4334:Iars2 UTSW 1 185303394 missense probably benign 0.35
R4708:Iars2 UTSW 1 185289357 missense probably benign 0.00
R4723:Iars2 UTSW 1 185315979 missense probably damaging 1.00
R4729:Iars2 UTSW 1 185316051 missense possibly damaging 0.71
R4851:Iars2 UTSW 1 185327648 missense probably damaging 0.99
R5033:Iars2 UTSW 1 185317928 missense possibly damaging 0.65
R5215:Iars2 UTSW 1 185294769 missense probably damaging 1.00
R5260:Iars2 UTSW 1 185323734 missense probably damaging 1.00
R5286:Iars2 UTSW 1 185323121 intron probably benign
R5614:Iars2 UTSW 1 185289508 missense probably benign 0.00
R6659:Iars2 UTSW 1 185288076 missense possibly damaging 0.76
R7057:Iars2 UTSW 1 185289367 missense probably benign 0.03
R7462:Iars2 UTSW 1 185322866 missense probably damaging 1.00
R7690:Iars2 UTSW 1 185320997 missense probably damaging 1.00
R8021:Iars2 UTSW 1 185322457 missense probably benign 0.05
R8097:Iars2 UTSW 1 185329389 unclassified probably benign
R8198:Iars2 UTSW 1 185297506 missense probably benign 0.19
R8283:Iars2 UTSW 1 185288091 nonsense probably null
R8543:Iars2 UTSW 1 185287144 missense probably benign 0.00
R8710:Iars2 UTSW 1 185295586 missense probably benign 0.13
R8713:Iars2 UTSW 1 185291418 missense possibly damaging 0.58
Z1177:Iars2 UTSW 1 185315895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCGGGCTTCACTTTGGAAC -3'
(R):5'- CTCTTCAAGGGTCTCTACCTTTAGG -3'

Sequencing Primer
(F):5'- GCTTCACTTTGGAACCCGGC -3'
(R):5'- TTTAGGTACCGGGCGGC -3'
Posted On2018-10-18