Incidental Mutation 'R6838:Zfp937'
ID537935
Institutional Source Beutler Lab
Gene Symbol Zfp937
Ensembl Gene ENSMUSG00000060336
Gene Namezinc finger protein 937
SynonymsGm4979
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6838 (G1)
Quality Score176.009
Status Validated
Chromosome2
Chromosomal Location150218073-150240725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150239346 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 432 (I432K)
Ref Sequence ENSEMBL: ENSMUSP00000073454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073782]
Predicted Effect probably benign
Transcript: ENSMUST00000073782
AA Change: I432K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000073454
Gene: ENSMUSG00000060336
AA Change: I432K

DomainStartEndE-ValueType
KRAB 4 66 8.19e-20 SMART
ZnF_C2H2 103 125 1.28e-3 SMART
ZnF_C2H2 131 153 2.53e-2 SMART
ZnF_C2H2 159 181 9.58e-3 SMART
ZnF_C2H2 187 209 2.09e-3 SMART
ZnF_C2H2 215 237 2.2e-2 SMART
ZnF_C2H2 243 265 2.2e-2 SMART
ZnF_C2H2 271 293 2.2e-2 SMART
ZnF_C2H2 299 321 1.82e-3 SMART
ZnF_C2H2 327 349 3.69e-4 SMART
ZnF_C2H2 355 377 4.47e-3 SMART
ZnF_C2H2 383 405 3.89e-3 SMART
ZnF_C2H2 411 433 4.79e-3 SMART
ZnF_C2H2 439 461 8.47e-4 SMART
ZnF_C2H2 467 490 7.26e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Other mutations in Zfp937
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0350:Zfp937 UTSW 2 150239302 missense possibly damaging 0.91
R0449:Zfp937 UTSW 2 150239546 missense probably benign 0.13
R1403:Zfp937 UTSW 2 150238948 nonsense probably null
R1403:Zfp937 UTSW 2 150238948 nonsense probably null
R1465:Zfp937 UTSW 2 150239047 nonsense probably null
R1465:Zfp937 UTSW 2 150239047 nonsense probably null
R4510:Zfp937 UTSW 2 150238511 missense probably damaging 0.98
R4511:Zfp937 UTSW 2 150238511 missense probably damaging 0.98
R4689:Zfp937 UTSW 2 150236786 missense probably damaging 1.00
R5290:Zfp937 UTSW 2 150238309 nonsense probably null
R6287:Zfp937 UTSW 2 150238341 missense possibly damaging 0.89
R6701:Zfp937 UTSW 2 150239216 missense probably damaging 1.00
R6746:Zfp937 UTSW 2 150239423 nonsense probably null
R7162:Zfp937 UTSW 2 150239519 missense probably benign 0.35
R7213:Zfp937 UTSW 2 150239465 missense probably damaging 1.00
R7441:Zfp937 UTSW 2 150238710 frame shift probably null
R7481:Zfp937 UTSW 2 150239346 missense probably benign 0.01
R7694:Zfp937 UTSW 2 150239348 missense probably damaging 1.00
R7856:Zfp937 UTSW 2 150239547 missense probably benign 0.23
R7902:Zfp937 UTSW 2 150238761 missense probably damaging 1.00
R7939:Zfp937 UTSW 2 150239547 missense probably benign 0.23
R7985:Zfp937 UTSW 2 150238761 missense probably damaging 1.00
R8058:Zfp937 UTSW 2 150239501 missense probably benign 0.00
X0017:Zfp937 UTSW 2 150218161 utr 5 prime probably null
Predicted Primers PCR Primer
(F):5'- TAAGGCATTTGCATGTCAAGCT -3'
(R):5'- AAGGCTTGATCTGATGTAGTGTACA -3'

Sequencing Primer
(F):5'- GCATGTCAAGCTAGTCTCCTGAATC -3'
(R):5'- TGTCTGACATGCCAAGGCTAGATC -3'
Posted On2018-10-18