Incidental Mutation 'R6838:Kif17'
ID537938
Institutional Source Beutler Lab
Gene Symbol Kif17
Ensembl Gene ENSMUSG00000028758
Gene Namekinesin family member 17
SynonymsN-4 kinesin, 5930435E01Rik, Kif17b
MMRRC Submission
Accession Numbers

Genbank: NM_010623; MGI: 1098229

Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R6838 (G1)
Quality Score148.008
Status Validated
Chromosome4
Chromosomal Location138250435-138301967 bp(+) (GRCm38)
Type of Mutationintron (151 bp from exon)
DNA Base Change (assembly) A to T at 138278399 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030539] [ENSMUST00000105818] [ENSMUST00000105821]
Predicted Effect probably null
Transcript: ENSMUST00000030539
SMART Domains Protein: ENSMUSP00000030539
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
coiled coil region 400 470 N/A INTRINSIC
low complexity region 723 736 N/A INTRINSIC
coiled coil region 806 852 N/A INTRINSIC
low complexity region 983 1000 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105818
SMART Domains Protein: ENSMUSP00000101444
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 1 151 1.46e-13 SMART
coiled coil region 208 278 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
coiled coil region 615 661 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105821
SMART Domains Protein: ENSMUSP00000101447
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
low complexity region 486 499 N/A INTRINSIC
coiled coil region 569 615 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired anterograde neuron transport, reduced NMDA-mediated synaptic currents, impaired synaptic plasticity, impaired long term object recognition memory, impaired spatial learning, and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Kif17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Kif17 APN 4 138262708 missense possibly damaging 0.66
IGL00973:Kif17 APN 4 138275057 missense probably benign 0.06
IGL01527:Kif17 APN 4 138269086 missense probably benign 0.21
IGL01559:Kif17 APN 4 138293769 missense probably damaging 0.99
IGL01736:Kif17 APN 4 138286565 missense possibly damaging 0.96
IGL02671:Kif17 APN 4 138288061 missense possibly damaging 0.85
IGL02976:Kif17 APN 4 138269063 missense probably damaging 1.00
IGL03051:Kif17 APN 4 138289254 missense probably damaging 0.99
IGL03285:Kif17 APN 4 138268990 missense probably damaging 0.97
easy_company UTSW 4 138288332 nonsense probably null
fiddle UTSW 4 138286480 missense probably benign 0.18
fidget UTSW 4 138269891 missense probably damaging 1.00
A5278:Kif17 UTSW 4 138287950 missense probably benign 0.33
R0012:Kif17 UTSW 4 138293748 missense probably damaging 0.99
R0012:Kif17 UTSW 4 138293748 missense probably damaging 0.99
R0133:Kif17 UTSW 4 138278245 missense possibly damaging 0.73
R0627:Kif17 UTSW 4 138288487 critical splice donor site probably null
R0670:Kif17 UTSW 4 138262499 unclassified probably benign
R0894:Kif17 UTSW 4 138298231 missense possibly damaging 0.93
R1367:Kif17 UTSW 4 138277994 nonsense probably null
R1648:Kif17 UTSW 4 138269895 missense probably damaging 1.00
R1674:Kif17 UTSW 4 138301258 missense probably benign 0.13
R1700:Kif17 UTSW 4 138262698 nonsense probably null
R1855:Kif17 UTSW 4 138288271 missense probably benign 0.44
R2137:Kif17 UTSW 4 138262667 missense probably damaging 0.98
R2170:Kif17 UTSW 4 138288371 missense probably benign 0.01
R3008:Kif17 UTSW 4 138278165 missense probably damaging 1.00
R3855:Kif17 UTSW 4 138291510 missense probably benign 0.18
R4591:Kif17 UTSW 4 138277799 missense probably benign 0.06
R4789:Kif17 UTSW 4 138281377 missense probably damaging 1.00
R5407:Kif17 UTSW 4 138298221 missense probably damaging 1.00
R5859:Kif17 UTSW 4 138291433 missense possibly damaging 0.71
R5901:Kif17 UTSW 4 138298332 splice site probably null
R5919:Kif17 UTSW 4 138269891 missense probably damaging 1.00
R6119:Kif17 UTSW 4 138288332 nonsense probably null
R6312:Kif17 UTSW 4 138288193 missense probably benign 0.40
R6693:Kif17 UTSW 4 138286480 missense probably benign 0.18
R6774:Kif17 UTSW 4 138274995 missense probably damaging 1.00
R6863:Kif17 UTSW 4 138269884 nonsense probably null
R7205:Kif17 UTSW 4 138293766 missense probably benign 0.21
R7307:Kif17 UTSW 4 138262643 missense probably benign 0.00
R7336:Kif17 UTSW 4 138298306 missense possibly damaging 0.76
R7594:Kif17 UTSW 4 138277925 missense probably damaging 1.00
R7806:Kif17 UTSW 4 138288196 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGCTTCGAGAGTACCAGGAAG -3'
(R):5'- GGATGTGAGTCACCCAGATG -3'

Sequencing Primer
(F):5'- TATCCTCGCCCAGCAGATG -3'
(R):5'- GATGCTAAGAACATGATGTCCCTGC -3'
Posted On2018-10-18