Incidental Mutation 'R6838:Thsd7a'
ID 537945
Institutional Source Beutler Lab
Gene Symbol Thsd7a
Ensembl Gene ENSMUSG00000032625
Gene Name thrombospondin, type I, domain containing 7A
Synonyms LOC330267
MMRRC Submission 044946-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6838 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 12311607-12749252 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 12504074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 360 (P360Q)
Ref Sequence ENSEMBL: ENSMUSP00000131662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000119581
AA Change: P360Q

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: P360Q

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1082 9.09e-8 SMART
TSP1 1085 1150 5.82e-1 SMART
TSP1 1155 1207 4.24e-2 SMART
TSP1 1210 1271 1e0 SMART
TSP1 1276 1328 3.55e-10 SMART
TSP1 1329 1399 7.5e-2 SMART
TSP1 1404 1462 1.55e-1 SMART
transmembrane domain 1594 1616 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172356
AA Change: P360Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: P360Q

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.95e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,291,546 (GRCm39) T317R probably damaging Het
Aqp9 T A 9: 71,019,498 (GRCm39) M321L probably benign Het
Avil G A 10: 126,849,431 (GRCm39) D576N probably benign Het
Bbs1 C T 19: 4,953,880 (GRCm39) M94I possibly damaging Het
Bms1 A G 6: 118,393,455 (GRCm39) V139A probably benign Het
Bscl2 A T 19: 8,818,745 (GRCm39) M57L probably damaging Het
C2cd5 A G 6: 142,975,364 (GRCm39) I794T possibly damaging Het
Cacna1s C T 1: 136,012,175 (GRCm39) T539I possibly damaging Het
Cand1 T C 10: 119,045,935 (GRCm39) K990R probably benign Het
Capn7 A G 14: 31,076,130 (GRCm39) I311V possibly damaging Het
Cd180 A G 13: 102,839,239 (GRCm39) N41D probably benign Het
Cdin1 T C 2: 115,607,471 (GRCm39) F275L possibly damaging Het
Celsr1 G A 15: 85,823,395 (GRCm39) T1671I probably benign Het
Cep135 A T 5: 76,780,062 (GRCm39) Q798L probably damaging Het
Cfap65 T C 1: 74,971,180 (GRCm39) D46G probably benign Het
Cracd A T 5: 77,006,056 (GRCm39) T806S unknown Het
Ddx46 G T 13: 55,787,748 (GRCm39) probably null Het
Dnah7b T C 1: 46,230,948 (GRCm39) L1402P probably damaging Het
Dnah8 A G 17: 30,929,525 (GRCm39) E1402G probably damaging Het
Dock9 A G 14: 121,784,008 (GRCm39) Y1989H possibly damaging Het
Ereg A G 5: 91,236,323 (GRCm39) D50G probably benign Het
Evi5 G T 5: 107,990,027 (GRCm39) T64K possibly damaging Het
Frem3 A C 8: 81,338,660 (GRCm39) T318P probably damaging Het
Gpx1 A G 9: 108,217,139 (GRCm39) D81G possibly damaging Het
Gramd1a T C 7: 30,833,929 (GRCm39) I499V probably benign Het
H4c12 A T 13: 21,934,375 (GRCm39) F101I probably damaging Het
Herc2 T A 7: 55,758,526 (GRCm39) D804E probably damaging Het
Hk1 T C 10: 62,107,437 (GRCm39) E846G probably damaging Het
Iars2 G A 1: 185,061,342 (GRCm39) A48V probably damaging Het
Invs C T 4: 48,283,278 (GRCm39) T10M possibly damaging Het
Ism2 A T 12: 87,326,975 (GRCm39) D321E probably benign Het
Itpr1 T C 6: 108,448,152 (GRCm39) S231P possibly damaging Het
Kif17 A T 4: 138,005,710 (GRCm39) probably null Het
Lvrn A G 18: 47,023,947 (GRCm39) I765V possibly damaging Het
Map4k4 T A 1: 40,015,882 (GRCm39) C108S probably damaging Het
Mapk13 G T 17: 28,996,535 (GRCm39) probably null Het
Mapkapk2 T A 1: 130,985,740 (GRCm39) K95* probably null Het
Mau2 A T 8: 70,491,947 (GRCm39) probably null Het
Mex3a A G 3: 88,444,084 (GRCm39) T387A probably benign Het
Myo5a T C 9: 75,061,165 (GRCm39) probably null Het
Ncbp3 A T 11: 72,964,300 (GRCm39) M417L possibly damaging Het
Nod2 A C 8: 89,397,086 (GRCm39) E810A possibly damaging Het
Nol3 A T 8: 106,006,207 (GRCm39) E152V probably damaging Het
Obox6 T C 7: 15,567,664 (GRCm39) E261G possibly damaging Het
Or2h1 A T 17: 37,404,058 (GRCm39) L236* probably null Het
Or8b12b A C 9: 37,684,348 (GRCm39) Y131S possibly damaging Het
P3h2 T C 16: 25,924,034 (GRCm39) S134G possibly damaging Het
Plxna2 A T 1: 194,487,222 (GRCm39) R1592S possibly damaging Het
Ppp1r12a C T 10: 108,097,137 (GRCm39) S250L possibly damaging Het
Rab38 A G 7: 88,099,917 (GRCm39) D144G possibly damaging Het
Septin1 T C 7: 126,815,894 (GRCm39) M176V probably benign Het
Spata22 C T 11: 73,236,759 (GRCm39) T355M probably benign Het
Tango6 A G 8: 107,468,706 (GRCm39) N734S probably benign Het
Tbc1d17 C A 7: 44,493,738 (GRCm39) R295L probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tnnt1 T C 7: 4,510,406 (GRCm39) N239S possibly damaging Het
Tpst1 A T 5: 130,131,279 (GRCm39) M250L probably benign Het
Urb1 T A 16: 90,578,994 (GRCm39) D689V possibly damaging Het
Usp28 T A 9: 48,911,730 (GRCm39) probably null Het
Vldlr G A 19: 27,225,370 (GRCm39) D816N probably damaging Het
Vmn1r257 T A 7: 22,391,142 (GRCm39) M201L probably benign Het
Wdr1 A G 5: 38,687,374 (GRCm39) V219A probably damaging Het
Xndc1 T C 7: 101,722,476 (GRCm39) V47A possibly damaging Het
Zfp366 C T 13: 99,365,015 (GRCm39) P59S possibly damaging Het
Zfp366 A G 13: 99,382,685 (GRCm39) E616G possibly damaging Het
Zfp937 T A 2: 150,081,266 (GRCm39) I432K probably benign Het
Other mutations in Thsd7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Thsd7a APN 6 12,379,658 (GRCm39) splice site probably null
IGL00563:Thsd7a APN 6 12,379,658 (GRCm39) splice site probably null
IGL00753:Thsd7a APN 6 12,327,528 (GRCm39) missense probably damaging 1.00
IGL00835:Thsd7a APN 6 12,554,933 (GRCm39) missense probably damaging 1.00
IGL01486:Thsd7a APN 6 12,471,079 (GRCm39) missense probably damaging 1.00
IGL01730:Thsd7a APN 6 12,554,980 (GRCm39) missense probably benign 0.05
IGL01931:Thsd7a APN 6 12,504,098 (GRCm39) missense probably damaging 1.00
IGL01935:Thsd7a APN 6 12,317,418 (GRCm39) missense probably damaging 1.00
IGL01978:Thsd7a APN 6 12,331,005 (GRCm39) missense probably benign 0.01
IGL02233:Thsd7a APN 6 12,555,257 (GRCm39) missense probably benign 0.00
IGL02354:Thsd7a APN 6 12,348,192 (GRCm39) splice site probably benign
IGL02361:Thsd7a APN 6 12,348,192 (GRCm39) splice site probably benign
IGL02375:Thsd7a APN 6 12,343,264 (GRCm39) missense probably damaging 1.00
IGL02468:Thsd7a APN 6 12,318,170 (GRCm39) missense probably damaging 0.98
IGL02616:Thsd7a APN 6 12,408,984 (GRCm39) missense probably damaging 0.98
IGL02820:Thsd7a APN 6 12,321,071 (GRCm39) missense probably damaging 1.00
IGL02858:Thsd7a APN 6 12,500,994 (GRCm39) missense probably benign 0.16
IGL03074:Thsd7a APN 6 12,324,680 (GRCm39) missense probably damaging 0.99
IGL03234:Thsd7a APN 6 12,343,177 (GRCm39) missense probably damaging 1.00
IGL03244:Thsd7a APN 6 12,504,167 (GRCm39) splice site probably benign
IGL03337:Thsd7a APN 6 12,405,173 (GRCm39) missense probably damaging 1.00
G1patch:Thsd7a UTSW 6 12,555,630 (GRCm39) missense possibly damaging 0.87
PIT4354001:Thsd7a UTSW 6 12,331,926 (GRCm39) critical splice donor site probably null
R0095:Thsd7a UTSW 6 12,320,969 (GRCm39) missense probably damaging 0.99
R0127:Thsd7a UTSW 6 12,554,907 (GRCm39) missense probably benign 0.01
R0142:Thsd7a UTSW 6 12,418,334 (GRCm39) missense probably damaging 1.00
R0226:Thsd7a UTSW 6 12,321,899 (GRCm39) missense possibly damaging 0.94
R0242:Thsd7a UTSW 6 12,503,915 (GRCm39) missense probably benign 0.32
R0242:Thsd7a UTSW 6 12,503,915 (GRCm39) missense probably benign 0.32
R0359:Thsd7a UTSW 6 12,352,030 (GRCm39) missense probably damaging 1.00
R0365:Thsd7a UTSW 6 12,321,886 (GRCm39) critical splice donor site probably null
R0504:Thsd7a UTSW 6 12,379,593 (GRCm39) missense probably damaging 0.99
R0512:Thsd7a UTSW 6 12,379,604 (GRCm39) missense possibly damaging 0.67
R0540:Thsd7a UTSW 6 12,331,541 (GRCm39) splice site probably null
R0577:Thsd7a UTSW 6 12,321,047 (GRCm39) missense possibly damaging 0.50
R0607:Thsd7a UTSW 6 12,331,541 (GRCm39) splice site probably null
R0755:Thsd7a UTSW 6 12,555,368 (GRCm39) missense probably damaging 1.00
R0771:Thsd7a UTSW 6 12,327,576 (GRCm39) missense probably benign 0.09
R0780:Thsd7a UTSW 6 12,337,273 (GRCm39) missense probably damaging 1.00
R0870:Thsd7a UTSW 6 12,337,273 (GRCm39) missense probably damaging 1.00
R0871:Thsd7a UTSW 6 12,337,273 (GRCm39) missense probably damaging 1.00
R0872:Thsd7a UTSW 6 12,337,273 (GRCm39) missense probably damaging 1.00
R0873:Thsd7a UTSW 6 12,337,273 (GRCm39) missense probably damaging 1.00
R1102:Thsd7a UTSW 6 12,555,701 (GRCm39) missense possibly damaging 0.58
R1144:Thsd7a UTSW 6 12,471,026 (GRCm39) splice site probably benign
R1265:Thsd7a UTSW 6 12,317,418 (GRCm39) missense probably damaging 0.99
R1276:Thsd7a UTSW 6 12,418,369 (GRCm39) missense probably damaging 1.00
R1381:Thsd7a UTSW 6 12,555,438 (GRCm39) missense probably damaging 1.00
R1473:Thsd7a UTSW 6 12,338,621 (GRCm39) missense probably benign 0.08
R1519:Thsd7a UTSW 6 12,471,174 (GRCm39) missense probably benign 0.01
R1633:Thsd7a UTSW 6 12,471,103 (GRCm39) nonsense probably null
R1659:Thsd7a UTSW 6 12,504,063 (GRCm39) missense possibly damaging 0.73
R1769:Thsd7a UTSW 6 12,555,714 (GRCm39) nonsense probably null
R1824:Thsd7a UTSW 6 12,409,041 (GRCm39) splice site probably null
R1840:Thsd7a UTSW 6 12,330,973 (GRCm39) missense probably benign 0.03
R1845:Thsd7a UTSW 6 12,321,040 (GRCm39) missense probably damaging 1.00
R1874:Thsd7a UTSW 6 12,555,434 (GRCm39) missense possibly damaging 0.76
R2023:Thsd7a UTSW 6 12,327,535 (GRCm39) missense probably benign 0.16
R2039:Thsd7a UTSW 6 12,408,922 (GRCm39) missense possibly damaging 0.77
R2058:Thsd7a UTSW 6 12,318,105 (GRCm39) splice site probably benign
R2138:Thsd7a UTSW 6 12,471,072 (GRCm39) nonsense probably null
R2155:Thsd7a UTSW 6 12,379,632 (GRCm39) missense probably damaging 1.00
R2175:Thsd7a UTSW 6 12,331,943 (GRCm39) missense possibly damaging 0.95
R2216:Thsd7a UTSW 6 12,337,267 (GRCm39) missense possibly damaging 0.95
R2318:Thsd7a UTSW 6 12,405,146 (GRCm39) missense probably damaging 1.00
R2375:Thsd7a UTSW 6 12,337,361 (GRCm39) missense probably damaging 1.00
R3857:Thsd7a UTSW 6 12,555,225 (GRCm39) missense probably benign 0.15
R3858:Thsd7a UTSW 6 12,555,225 (GRCm39) missense probably benign 0.15
R3890:Thsd7a UTSW 6 12,418,336 (GRCm39) missense probably benign 0.09
R3910:Thsd7a UTSW 6 12,331,548 (GRCm39) missense probably damaging 0.96
R3933:Thsd7a UTSW 6 12,555,225 (GRCm39) missense probably benign 0.15
R4369:Thsd7a UTSW 6 12,468,907 (GRCm39) missense probably damaging 1.00
R4447:Thsd7a UTSW 6 12,324,634 (GRCm39) missense probably damaging 0.98
R4664:Thsd7a UTSW 6 12,504,012 (GRCm39) missense possibly damaging 0.90
R4664:Thsd7a UTSW 6 12,337,313 (GRCm39) missense possibly damaging 0.79
R4665:Thsd7a UTSW 6 12,504,012 (GRCm39) missense possibly damaging 0.90
R4665:Thsd7a UTSW 6 12,337,313 (GRCm39) missense possibly damaging 0.79
R4666:Thsd7a UTSW 6 12,504,012 (GRCm39) missense possibly damaging 0.90
R4666:Thsd7a UTSW 6 12,337,313 (GRCm39) missense possibly damaging 0.79
R4668:Thsd7a UTSW 6 12,408,967 (GRCm39) missense probably damaging 0.98
R4886:Thsd7a UTSW 6 12,327,659 (GRCm39) nonsense probably null
R4918:Thsd7a UTSW 6 12,327,558 (GRCm39) missense probably damaging 1.00
R4938:Thsd7a UTSW 6 12,330,991 (GRCm39) missense probably benign 0.09
R5064:Thsd7a UTSW 6 12,330,951 (GRCm39) missense possibly damaging 0.66
R5153:Thsd7a UTSW 6 12,338,654 (GRCm39) missense probably benign 0.00
R5177:Thsd7a UTSW 6 12,379,582 (GRCm39) nonsense probably null
R5242:Thsd7a UTSW 6 12,327,582 (GRCm39) missense probably damaging 1.00
R5267:Thsd7a UTSW 6 12,379,601 (GRCm39) missense probably damaging 1.00
R5442:Thsd7a UTSW 6 12,748,799 (GRCm39) missense probably benign 0.00
R5506:Thsd7a UTSW 6 12,332,016 (GRCm39) missense possibly damaging 0.85
R5525:Thsd7a UTSW 6 12,332,006 (GRCm39) missense possibly damaging 0.52
R5544:Thsd7a UTSW 6 12,379,470 (GRCm39) missense possibly damaging 0.94
R5651:Thsd7a UTSW 6 12,343,212 (GRCm39) missense probably damaging 1.00
R5716:Thsd7a UTSW 6 12,343,147 (GRCm39) missense probably benign 0.00
R5848:Thsd7a UTSW 6 12,503,922 (GRCm39) missense probably damaging 1.00
R5958:Thsd7a UTSW 6 12,337,261 (GRCm39) missense probably benign 0.02
R6012:Thsd7a UTSW 6 12,379,388 (GRCm39) splice site probably null
R6139:Thsd7a UTSW 6 12,379,572 (GRCm39) missense possibly damaging 0.93
R6243:Thsd7a UTSW 6 12,327,601 (GRCm39) missense probably damaging 1.00
R6257:Thsd7a UTSW 6 12,408,987 (GRCm39) nonsense probably null
R6273:Thsd7a UTSW 6 12,408,835 (GRCm39) missense probably damaging 0.99
R6300:Thsd7a UTSW 6 12,471,103 (GRCm39) nonsense probably null
R6314:Thsd7a UTSW 6 12,554,996 (GRCm39) missense possibly damaging 0.87
R6392:Thsd7a UTSW 6 12,468,928 (GRCm39) missense probably damaging 0.99
R6418:Thsd7a UTSW 6 12,555,081 (GRCm39) nonsense probably null
R6515:Thsd7a UTSW 6 12,501,085 (GRCm39) missense possibly damaging 0.47
R6725:Thsd7a UTSW 6 12,555,630 (GRCm39) missense possibly damaging 0.87
R6742:Thsd7a UTSW 6 12,408,815 (GRCm39) missense probably damaging 1.00
R6776:Thsd7a UTSW 6 12,555,636 (GRCm39) missense possibly damaging 0.53
R7104:Thsd7a UTSW 6 12,379,429 (GRCm39) missense
R7170:Thsd7a UTSW 6 12,352,090 (GRCm39) missense
R7349:Thsd7a UTSW 6 12,352,067 (GRCm39) missense
R7460:Thsd7a UTSW 6 12,554,933 (GRCm39) missense
R7467:Thsd7a UTSW 6 12,331,584 (GRCm39) missense
R7666:Thsd7a UTSW 6 12,379,437 (GRCm39) missense
R7869:Thsd7a UTSW 6 12,471,123 (GRCm39) nonsense probably null
R8032:Thsd7a UTSW 6 12,555,287 (GRCm39) missense
R8165:Thsd7a UTSW 6 12,468,962 (GRCm39) missense
R8167:Thsd7a UTSW 6 12,317,400 (GRCm39) nonsense probably null
R8245:Thsd7a UTSW 6 12,379,592 (GRCm39) missense
R8310:Thsd7a UTSW 6 12,396,612 (GRCm39) missense
R8312:Thsd7a UTSW 6 12,471,181 (GRCm39) missense
R8331:Thsd7a UTSW 6 12,471,157 (GRCm39) missense
R8755:Thsd7a UTSW 6 12,408,851 (GRCm39) nonsense probably null
R8843:Thsd7a UTSW 6 12,501,136 (GRCm39) missense
R8867:Thsd7a UTSW 6 12,338,686 (GRCm39) missense
R8952:Thsd7a UTSW 6 12,468,992 (GRCm39) missense probably damaging 0.98
R9036:Thsd7a UTSW 6 12,418,249 (GRCm39) missense
R9299:Thsd7a UTSW 6 12,504,131 (GRCm39) missense
R9366:Thsd7a UTSW 6 12,555,480 (GRCm39) missense
R9489:Thsd7a UTSW 6 12,352,022 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AAGGGACATGCCATTTGAGCAC -3'
(R):5'- TTGTACATTATGCGCCCACATAG -3'

Sequencing Primer
(F):5'- TGCCATTTGAGCACACCACG -3'
(R):5'- TATGCGCCCACATAGAAATTAAACTG -3'
Posted On 2018-10-18