Incidental Mutation 'R6838:Itpr1'
ID 537946
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Name inositol 1,4,5-trisphosphate receptor 1
Synonyms opt, IP3R1, P400, wblo, Ip3r, Pcp-1, Itpr-1, InsP3R type I, Pcp1
MMRRC Submission 044946-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.736) question?
Stock # R6838 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 108190057-108528070 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108448152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 231 (S231P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032192
AA Change: S1896P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: S1896P

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203615
AA Change: S1895P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: S1895P

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203638
AA Change: S231P

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,291,546 (GRCm39) T317R probably damaging Het
Aqp9 T A 9: 71,019,498 (GRCm39) M321L probably benign Het
Avil G A 10: 126,849,431 (GRCm39) D576N probably benign Het
Bbs1 C T 19: 4,953,880 (GRCm39) M94I possibly damaging Het
Bms1 A G 6: 118,393,455 (GRCm39) V139A probably benign Het
Bscl2 A T 19: 8,818,745 (GRCm39) M57L probably damaging Het
C2cd5 A G 6: 142,975,364 (GRCm39) I794T possibly damaging Het
Cacna1s C T 1: 136,012,175 (GRCm39) T539I possibly damaging Het
Cand1 T C 10: 119,045,935 (GRCm39) K990R probably benign Het
Capn7 A G 14: 31,076,130 (GRCm39) I311V possibly damaging Het
Cd180 A G 13: 102,839,239 (GRCm39) N41D probably benign Het
Cdin1 T C 2: 115,607,471 (GRCm39) F275L possibly damaging Het
Celsr1 G A 15: 85,823,395 (GRCm39) T1671I probably benign Het
Cep135 A T 5: 76,780,062 (GRCm39) Q798L probably damaging Het
Cfap65 T C 1: 74,971,180 (GRCm39) D46G probably benign Het
Cracd A T 5: 77,006,056 (GRCm39) T806S unknown Het
Ddx46 G T 13: 55,787,748 (GRCm39) probably null Het
Dnah7b T C 1: 46,230,948 (GRCm39) L1402P probably damaging Het
Dnah8 A G 17: 30,929,525 (GRCm39) E1402G probably damaging Het
Dock9 A G 14: 121,784,008 (GRCm39) Y1989H possibly damaging Het
Ereg A G 5: 91,236,323 (GRCm39) D50G probably benign Het
Evi5 G T 5: 107,990,027 (GRCm39) T64K possibly damaging Het
Frem3 A C 8: 81,338,660 (GRCm39) T318P probably damaging Het
Gpx1 A G 9: 108,217,139 (GRCm39) D81G possibly damaging Het
Gramd1a T C 7: 30,833,929 (GRCm39) I499V probably benign Het
H4c12 A T 13: 21,934,375 (GRCm39) F101I probably damaging Het
Herc2 T A 7: 55,758,526 (GRCm39) D804E probably damaging Het
Hk1 T C 10: 62,107,437 (GRCm39) E846G probably damaging Het
Iars2 G A 1: 185,061,342 (GRCm39) A48V probably damaging Het
Invs C T 4: 48,283,278 (GRCm39) T10M possibly damaging Het
Ism2 A T 12: 87,326,975 (GRCm39) D321E probably benign Het
Kif17 A T 4: 138,005,710 (GRCm39) probably null Het
Lvrn A G 18: 47,023,947 (GRCm39) I765V possibly damaging Het
Map4k4 T A 1: 40,015,882 (GRCm39) C108S probably damaging Het
Mapk13 G T 17: 28,996,535 (GRCm39) probably null Het
Mapkapk2 T A 1: 130,985,740 (GRCm39) K95* probably null Het
Mau2 A T 8: 70,491,947 (GRCm39) probably null Het
Mex3a A G 3: 88,444,084 (GRCm39) T387A probably benign Het
Myo5a T C 9: 75,061,165 (GRCm39) probably null Het
Ncbp3 A T 11: 72,964,300 (GRCm39) M417L possibly damaging Het
Nod2 A C 8: 89,397,086 (GRCm39) E810A possibly damaging Het
Nol3 A T 8: 106,006,207 (GRCm39) E152V probably damaging Het
Obox6 T C 7: 15,567,664 (GRCm39) E261G possibly damaging Het
Or2h1 A T 17: 37,404,058 (GRCm39) L236* probably null Het
Or8b12b A C 9: 37,684,348 (GRCm39) Y131S possibly damaging Het
P3h2 T C 16: 25,924,034 (GRCm39) S134G possibly damaging Het
Plxna2 A T 1: 194,487,222 (GRCm39) R1592S possibly damaging Het
Ppp1r12a C T 10: 108,097,137 (GRCm39) S250L possibly damaging Het
Rab38 A G 7: 88,099,917 (GRCm39) D144G possibly damaging Het
Septin1 T C 7: 126,815,894 (GRCm39) M176V probably benign Het
Spata22 C T 11: 73,236,759 (GRCm39) T355M probably benign Het
Tango6 A G 8: 107,468,706 (GRCm39) N734S probably benign Het
Tbc1d17 C A 7: 44,493,738 (GRCm39) R295L probably damaging Het
Thsd7a G T 6: 12,504,074 (GRCm39) P360Q probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tnnt1 T C 7: 4,510,406 (GRCm39) N239S possibly damaging Het
Tpst1 A T 5: 130,131,279 (GRCm39) M250L probably benign Het
Urb1 T A 16: 90,578,994 (GRCm39) D689V possibly damaging Het
Usp28 T A 9: 48,911,730 (GRCm39) probably null Het
Vldlr G A 19: 27,225,370 (GRCm39) D816N probably damaging Het
Vmn1r257 T A 7: 22,391,142 (GRCm39) M201L probably benign Het
Wdr1 A G 5: 38,687,374 (GRCm39) V219A probably damaging Het
Xndc1 T C 7: 101,722,476 (GRCm39) V47A possibly damaging Het
Zfp366 C T 13: 99,365,015 (GRCm39) P59S possibly damaging Het
Zfp366 A G 13: 99,382,685 (GRCm39) E616G possibly damaging Het
Zfp937 T A 2: 150,081,266 (GRCm39) I432K probably benign Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108,448,081 (GRCm39) missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108,390,781 (GRCm39) missense probably benign 0.00
IGL01105:Itpr1 APN 6 108,358,294 (GRCm39) missense probably benign 0.00
IGL01296:Itpr1 APN 6 108,376,322 (GRCm39) missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108,358,169 (GRCm39) missense probably benign 0.01
IGL01418:Itpr1 APN 6 108,316,585 (GRCm39) critical splice donor site probably null
IGL01464:Itpr1 APN 6 108,363,688 (GRCm39) missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108,465,457 (GRCm39) missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108,450,560 (GRCm39) missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108,357,993 (GRCm39) nonsense probably null
IGL01969:Itpr1 APN 6 108,354,652 (GRCm39) missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108,366,444 (GRCm39) missense probably benign 0.08
IGL02206:Itpr1 APN 6 108,526,781 (GRCm39) missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108,394,884 (GRCm39) missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108,316,478 (GRCm39) missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108,466,883 (GRCm39) splice site probably null
IGL02568:Itpr1 APN 6 108,316,515 (GRCm39) missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108,358,276 (GRCm39) missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108,394,942 (GRCm39) missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108,500,362 (GRCm39) missense probably benign 0.00
IGL03333:Itpr1 APN 6 108,357,871 (GRCm39) unclassified probably benign
aboriginal UTSW 6 108,492,908 (GRCm39) missense probably benign
approximation UTSW 6 108,371,802 (GRCm39) missense probably benign
estimate UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
icarus UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
marsupialized UTSW 6 108,371,034 (GRCm39) splice site probably null
primordial UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
roo UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
wallaby UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108,358,218 (GRCm39) missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108,470,718 (GRCm39) nonsense probably null
R0019:Itpr1 UTSW 6 108,331,587 (GRCm39) missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108,448,170 (GRCm39) splice site probably benign
R0129:Itpr1 UTSW 6 108,326,637 (GRCm39) missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108,465,443 (GRCm39) splice site probably benign
R0244:Itpr1 UTSW 6 108,450,550 (GRCm39) missense probably benign 0.00
R0391:Itpr1 UTSW 6 108,355,128 (GRCm39) missense probably benign 0.22
R0543:Itpr1 UTSW 6 108,492,709 (GRCm39) splice site probably benign
R0647:Itpr1 UTSW 6 108,360,659 (GRCm39) missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108,326,590 (GRCm39) missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108,487,657 (GRCm39) missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108,316,582 (GRCm39) missense probably benign 0.22
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1605:Itpr1 UTSW 6 108,326,620 (GRCm39) missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108,459,858 (GRCm39) missense probably benign 0.38
R1852:Itpr1 UTSW 6 108,363,667 (GRCm39) missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108,417,497 (GRCm39) missense probably benign 0.02
R2027:Itpr1 UTSW 6 108,363,814 (GRCm39) missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108,355,270 (GRCm39) unclassified probably benign
R2166:Itpr1 UTSW 6 108,365,186 (GRCm39) missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108,346,071 (GRCm39) missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108,383,070 (GRCm39) missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108,326,641 (GRCm39) missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108,358,231 (GRCm39) missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108,371,802 (GRCm39) missense probably benign
R4081:Itpr1 UTSW 6 108,368,796 (GRCm39) missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108,371,316 (GRCm39) missense probably benign
R4406:Itpr1 UTSW 6 108,331,624 (GRCm39) missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108,409,647 (GRCm39) missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108,458,184 (GRCm39) missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108,458,254 (GRCm39) missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108,387,892 (GRCm39) critical splice donor site probably null
R4760:Itpr1 UTSW 6 108,326,593 (GRCm39) missense probably benign 0.29
R4836:Itpr1 UTSW 6 108,366,498 (GRCm39) missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
R4876:Itpr1 UTSW 6 108,459,867 (GRCm39) missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108,417,519 (GRCm39) nonsense probably null
R5076:Itpr1 UTSW 6 108,382,490 (GRCm39) splice site probably null
R5088:Itpr1 UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108,519,023 (GRCm39) missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108,383,106 (GRCm39) missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108,333,472 (GRCm39) missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108,370,922 (GRCm39) missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108,364,459 (GRCm39) missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108,496,385 (GRCm39) missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108,470,755 (GRCm39) missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108,465,561 (GRCm39) missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108,329,104 (GRCm39) missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.23
R5869:Itpr1 UTSW 6 108,450,490 (GRCm39) missense probably benign 0.30
R5903:Itpr1 UTSW 6 108,466,758 (GRCm39) intron probably benign
R5929:Itpr1 UTSW 6 108,400,297 (GRCm39) missense probably benign
R5956:Itpr1 UTSW 6 108,482,988 (GRCm39) missense probably benign 0.25
R6160:Itpr1 UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
R6163:Itpr1 UTSW 6 108,365,245 (GRCm39) missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108,346,077 (GRCm39) missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108,355,164 (GRCm39) missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108,482,864 (GRCm39) missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108,394,933 (GRCm39) missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108,365,237 (GRCm39) missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108,340,644 (GRCm39) missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108,371,034 (GRCm39) splice site probably null
R6806:Itpr1 UTSW 6 108,492,908 (GRCm39) missense probably benign
R6841:Itpr1 UTSW 6 108,365,153 (GRCm39) missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108,458,355 (GRCm39) missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108,408,459 (GRCm39) critical splice donor site probably null
R7076:Itpr1 UTSW 6 108,365,257 (GRCm39) missense probably benign
R7116:Itpr1 UTSW 6 108,458,229 (GRCm39) missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108,371,368 (GRCm39) critical splice donor site probably null
R7161:Itpr1 UTSW 6 108,363,601 (GRCm39) missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108,355,151 (GRCm39) missense probably benign 0.06
R7241:Itpr1 UTSW 6 108,494,581 (GRCm39) critical splice donor site probably null
R7301:Itpr1 UTSW 6 108,518,985 (GRCm39) missense possibly damaging 0.86
R7330:Itpr1 UTSW 6 108,415,292 (GRCm39) missense probably benign 0.28
R7449:Itpr1 UTSW 6 108,366,345 (GRCm39) missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108,380,357 (GRCm39) missense probably benign 0.05
R7502:Itpr1 UTSW 6 108,360,639 (GRCm39) missense probably benign 0.00
R7779:Itpr1 UTSW 6 108,500,309 (GRCm39) missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108,459,892 (GRCm39) missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108,364,330 (GRCm39) missense probably damaging 1.00
R7974:Itpr1 UTSW 6 108,500,366 (GRCm39) missense possibly damaging 0.86
R7998:Itpr1 UTSW 6 108,394,909 (GRCm39) missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108,363,589 (GRCm39) missense probably damaging 1.00
R8136:Itpr1 UTSW 6 108,415,321 (GRCm39) missense probably benign 0.18
R8200:Itpr1 UTSW 6 108,371,826 (GRCm39) missense probably benign 0.00
R8242:Itpr1 UTSW 6 108,363,658 (GRCm39) missense probably benign 0.44
R8322:Itpr1 UTSW 6 108,365,190 (GRCm39) missense probably benign 0.05
R8377:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.00
R8412:Itpr1 UTSW 6 108,340,581 (GRCm39) missense probably benign 0.07
R8443:Itpr1 UTSW 6 108,496,309 (GRCm39) missense probably damaging 0.99
R8669:Itpr1 UTSW 6 108,370,928 (GRCm39) missense probably damaging 0.99
R8697:Itpr1 UTSW 6 108,500,327 (GRCm39) missense probably damaging 1.00
R8744:Itpr1 UTSW 6 108,354,763 (GRCm39) missense possibly damaging 0.79
R8870:Itpr1 UTSW 6 108,365,172 (GRCm39) missense probably damaging 1.00
R8921:Itpr1 UTSW 6 108,355,159 (GRCm39) missense possibly damaging 0.87
R8961:Itpr1 UTSW 6 108,470,666 (GRCm39) missense possibly damaging 0.86
R9095:Itpr1 UTSW 6 108,364,352 (GRCm39) missense probably benign 0.02
R9205:Itpr1 UTSW 6 108,466,810 (GRCm39) missense probably damaging 0.99
R9282:Itpr1 UTSW 6 108,370,984 (GRCm39) missense probably damaging 1.00
R9323:Itpr1 UTSW 6 108,328,979 (GRCm39) missense probably damaging 1.00
R9376:Itpr1 UTSW 6 108,326,638 (GRCm39) missense probably damaging 0.99
R9392:Itpr1 UTSW 6 108,390,837 (GRCm39) missense probably benign
R9428:Itpr1 UTSW 6 108,378,308 (GRCm39) missense possibly damaging 0.84
R9621:Itpr1 UTSW 6 108,393,870 (GRCm39) missense probably damaging 1.00
R9632:Itpr1 UTSW 6 108,382,481 (GRCm39) missense possibly damaging 0.50
R9646:Itpr1 UTSW 6 108,371,845 (GRCm39) missense probably damaging 1.00
R9695:Itpr1 UTSW 6 108,378,311 (GRCm39) missense probably damaging 1.00
R9710:Itpr1 UTSW 6 108,382,481 (GRCm39) missense possibly damaging 0.50
R9721:Itpr1 UTSW 6 108,383,063 (GRCm39) missense probably damaging 0.96
R9780:Itpr1 UTSW 6 108,487,795 (GRCm39) missense probably benign 0.03
Z1176:Itpr1 UTSW 6 108,476,110 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTAGGATCTCCATTTAATTTGG -3'
(R):5'- CTTTGTCCTGGCCACTTGAG -3'

Sequencing Primer
(F):5'- AGAATCTCTTCTCCATGACAGC -3'
(R):5'- CCACTTGAGAGGATGGCATAACC -3'
Posted On 2018-10-18