Incidental Mutation 'R6838:Tnnt1'
ID537949
Institutional Source Beutler Lab
Gene Symbol Tnnt1
Ensembl Gene ENSMUSG00000064179
Gene Nametroponin T1, skeletal, slow
SynonymsssTnT, sTnT, Tnt, skeletal muscle slow-twitch TnT
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6838 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4504570-4516382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4507407 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 239 (N239S)
Ref Sequence ENSEMBL: ENSMUSP00000137198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071798] [ENSMUST00000108587] [ENSMUST00000163538] [ENSMUST00000163710] [ENSMUST00000163722] [ENSMUST00000166161] [ENSMUST00000166268] [ENSMUST00000166959] [ENSMUST00000178163]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071798
AA Change: N239S

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071704
Gene: ENSMUSG00000064179
AA Change: N239S

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108587
AA Change: N240S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104228
Gene: ENSMUSG00000064179
AA Change: N240S

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 205 3e-36 PFAM
Pfam:Troponin 197 260 4.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163538
SMART Domains Protein: ENSMUSP00000127964
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 160 4.4e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163710
AA Change: N228S

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129626
Gene: ENSMUSG00000064179
AA Change: N228S

DomainStartEndE-ValueType
coiled coil region 2 29 N/A INTRINSIC
Pfam:Troponin 57 199 1.9e-39 PFAM
low complexity region 235 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163722
SMART Domains Protein: ENSMUSP00000129409
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 17 64 N/A INTRINSIC
Pfam:Troponin 76 118 1.9e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166161
AA Change: N227S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125795
Gene: ENSMUSG00000064179
AA Change: N227S

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Troponin 56 198 3.4e-40 PFAM
low complexity region 234 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166268
SMART Domains Protein: ENSMUSP00000128476
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
coiled coil region 2 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166959
SMART Domains Protein: ENSMUSP00000129109
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 192 1.5e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178163
AA Change: N239S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137198
Gene: ENSMUSG00000064179
AA Change: N239S

DomainStartEndE-ValueType
low complexity region 5 40 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: This gene encodes the slow skeletal tropomyosin-binding subunit of the troponin complex and plays an essential role in the regulation of striated muscle contraction. In humans, mutations in this gene are associated with nemaline myopathy type 5. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a null or hypomorphic allele show small and loss of type I slow skeletal muscle fibers with compensatory hypertrophy of type II fast fibers and reduced contractile force and tolerance of skeletal muscle fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Tnnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Tnnt1 APN 7 4507550 missense possibly damaging 0.96
IGL01391:Tnnt1 APN 7 4514212 critical splice donor site probably null
IGL01582:Tnnt1 APN 7 4509983 missense probably damaging 1.00
R0098:Tnnt1 UTSW 7 4509045 missense probably damaging 0.99
R0963:Tnnt1 UTSW 7 4507595 missense probably damaging 1.00
R1489:Tnnt1 UTSW 7 4507525 nonsense probably null
R2340:Tnnt1 UTSW 7 4513616 splice site probably benign
R4224:Tnnt1 UTSW 7 4510007 missense probably damaging 1.00
R4624:Tnnt1 UTSW 7 4512268 intron probably benign
R4969:Tnnt1 UTSW 7 4507574 missense probably damaging 1.00
R5245:Tnnt1 UTSW 7 4510067 missense probably damaging 1.00
R5822:Tnnt1 UTSW 7 4516346 nonsense probably null
R6520:Tnnt1 UTSW 7 4509061 nonsense probably null
R6556:Tnnt1 UTSW 7 4509577 missense probably damaging 1.00
R6573:Tnnt1 UTSW 7 4514334 splice site probably null
R7318:Tnnt1 UTSW 7 4510548 intron probably null
R7889:Tnnt1 UTSW 7 4508583 missense probably damaging 1.00
R7972:Tnnt1 UTSW 7 4508583 missense probably damaging 1.00
X0010:Tnnt1 UTSW 7 4509971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGATAGGATGTCTCAGGAAAC -3'
(R):5'- GAGCTGTCAGAATGGATCCACC -3'

Sequencing Primer
(F):5'- ATGTCTCAGGAAACAGACAGG -3'
(R):5'- CACCAGCTGGAATCAGAAAAATTTG -3'
Posted On2018-10-18