Incidental Mutation 'R6838:Tbc1d17'
ID537953
Institutional Source Beutler Lab
Gene Symbol Tbc1d17
Ensembl Gene ENSMUSG00000038520
Gene NameTBC1 domain family, member 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R6838 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44834623-44849079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44844314 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 295 (R295L)
Ref Sequence ENSEMBL: ENSMUSP00000121546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033015] [ENSMUST00000047085] [ENSMUST00000054343] [ENSMUST00000107885] [ENSMUST00000118125] [ENSMUST00000145959] [ENSMUST00000207293] [ENSMUST00000207532]
Predicted Effect probably benign
Transcript: ENSMUST00000033015
SMART Domains Protein: ENSMUSP00000033015
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:AlaDh_PNT_C 42 93 1.3e-9 PFAM
Pfam:Thi4 53 100 1.8e-8 PFAM
Pfam:FAD_binding_3 59 94 1.4e-7 PFAM
Pfam:HI0933_like 59 161 1.3e-8 PFAM
Pfam:FAD_binding_2 60 100 1.5e-8 PFAM
Pfam:Pyr_redox 60 100 1.9e-8 PFAM
Pfam:Pyr_redox_2 60 125 7.3e-8 PFAM
Pfam:DAO 60 140 2.8e-9 PFAM
Pfam:NAD_binding_8 63 130 3.6e-17 PFAM
Pfam:Amino_oxidase 68 503 9.9e-86 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000047085
AA Change: R295L

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520
AA Change: R295L

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054343
SMART Domains Protein: ENSMUSP00000049764
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107885
SMART Domains Protein: ENSMUSP00000103517
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 104 131 N/A INTRINSIC
low complexity region 137 172 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
Pfam:PRAS 199 323 1.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118125
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133279
SMART Domains Protein: ENSMUSP00000133613
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
PDB:1TDO|A 2 44 1e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000142880
Predicted Effect probably damaging
Transcript: ENSMUST00000145959
AA Change: R295L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121546
Gene: ENSMUSG00000038520
AA Change: R295L

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 5.8e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 544 3.91e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207293
Predicted Effect probably benign
Transcript: ENSMUST00000207532
Predicted Effect probably benign
Transcript: ENSMUST00000208714
Predicted Effect probably benign
Transcript: ENSMUST00000208890
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Tbc1d17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Tbc1d17 APN 7 44843085 missense probably benign 0.00
IGL00791:Tbc1d17 APN 7 44845313 missense probably benign 0.04
IGL01865:Tbc1d17 APN 7 44842689 missense possibly damaging 0.90
IGL02468:Tbc1d17 APN 7 44848329 missense probably benign
IGL02829:Tbc1d17 APN 7 44848872 unclassified probably benign
PIT4431001:Tbc1d17 UTSW 7 44845074 missense probably benign
R0035:Tbc1d17 UTSW 7 44841408 missense probably benign 0.09
R0035:Tbc1d17 UTSW 7 44841408 missense probably benign 0.09
R0066:Tbc1d17 UTSW 7 44844071 unclassified probably benign
R0066:Tbc1d17 UTSW 7 44844071 unclassified probably benign
R0414:Tbc1d17 UTSW 7 44846059 missense probably benign 0.00
R0574:Tbc1d17 UTSW 7 44843123 unclassified probably benign
R0626:Tbc1d17 UTSW 7 44843085 missense probably benign 0.00
R0960:Tbc1d17 UTSW 7 44848428 splice site probably benign
R1203:Tbc1d17 UTSW 7 44843471 missense probably damaging 1.00
R1244:Tbc1d17 UTSW 7 44844398 missense probably damaging 0.99
R1730:Tbc1d17 UTSW 7 44845131 missense probably damaging 0.99
R1783:Tbc1d17 UTSW 7 44845131 missense probably damaging 0.99
R1899:Tbc1d17 UTSW 7 44841633 unclassified probably benign
R1953:Tbc1d17 UTSW 7 44841398 unclassified probably null
R2106:Tbc1d17 UTSW 7 44848268 critical splice donor site probably null
R3889:Tbc1d17 UTSW 7 44845938 missense probably damaging 1.00
R4240:Tbc1d17 UTSW 7 44846826 missense probably damaging 1.00
R4547:Tbc1d17 UTSW 7 44841347 missense probably benign
R4787:Tbc1d17 UTSW 7 44843064 missense probably benign 0.02
R5422:Tbc1d17 UTSW 7 44848868 start codon destroyed probably null 0.98
R5569:Tbc1d17 UTSW 7 44848331 missense probably damaging 1.00
R5933:Tbc1d17 UTSW 7 44845337 missense probably damaging 0.96
R6502:Tbc1d17 UTSW 7 44841625 missense probably benign 0.30
R7543:Tbc1d17 UTSW 7 44846079 missense probably benign 0.00
Z1177:Tbc1d17 UTSW 7 44842671 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAACTTCCAAGCCTCTCG -3'
(R):5'- TTCCTAGCCTGGCCTTAGAGTG -3'

Sequencing Primer
(F):5'- TTCCAAGCCTCTCGACGTAGG -3'
(R):5'- GCCTTAGAGTGTGTGACCCTC -3'
Posted On2018-10-18