Incidental Mutation 'R6838:Frem3'
ID537959
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6838 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80612031 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 318 (T318P)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: T318P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: T318P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Meta Mutation Damage Score 0.3761 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
R7858:Frem3 UTSW 8 80611721 nonsense probably null
R7941:Frem3 UTSW 8 80611721 nonsense probably null
RF030:Frem3 UTSW 8 80615238 small insertion probably benign
RF034:Frem3 UTSW 8 80615238 small insertion probably benign
RF042:Frem3 UTSW 8 80615238 small insertion probably benign
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Z1176:Frem3 UTSW 8 80611503 missense probably damaging 0.99
Z1176:Frem3 UTSW 8 80615431 missense probably benign 0.03
Z1177:Frem3 UTSW 8 80616129 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CTATGTGCCCATGCTAGTGG -3'
(R):5'- AAAGACGTGGTCCCCTTCTG -3'

Sequencing Primer
(F):5'- CTAGTGGAGCTGCTTGGACCAG -3'
(R):5'- CGATAGGCTATTTTCAGCTCTCGAAG -3'
Posted On2018-10-18