Incidental Mutation 'R6838:Cand1'
ID 537970
Institutional Source Beutler Lab
Gene Symbol Cand1
Ensembl Gene ENSMUSG00000020114
Gene Name cullin associated and neddylation disassociated 1
Synonyms 6330512O03Rik, 2310038O07Rik, D10Ertd516e
MMRRC Submission 044946-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6838 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 119035160-119075960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119045935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 990 (K990R)
Ref Sequence ENSEMBL: ENSMUSP00000020315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020315]
AlphaFold Q6ZQ38
Predicted Effect probably benign
Transcript: ENSMUST00000020315
AA Change: K990R

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020315
Gene: ENSMUSG00000020114
AA Change: K990R

DomainStartEndE-ValueType
SCOP:d1qgra_ 53 994 4e-44 SMART
Pfam:TIP120 1040 1203 1.9e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of Cullin-RING ubiquitin ligases, which are in involved in ubiquitinylation of proteins degraded by the Ub proteasome system. The encoded protein binds to unneddylated cullin-RING box protein complexes and acts as an inhibitor of cullin neddylation and of Skp1, cullin, and F box ubiquitin ligase complex assembly and activity. In mammalian cell culture, this protein predominantly localizes to the cytoplasm. Knockdown of this gene in preadipocytes results in blocked adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,291,546 (GRCm39) T317R probably damaging Het
Aqp9 T A 9: 71,019,498 (GRCm39) M321L probably benign Het
Avil G A 10: 126,849,431 (GRCm39) D576N probably benign Het
Bbs1 C T 19: 4,953,880 (GRCm39) M94I possibly damaging Het
Bms1 A G 6: 118,393,455 (GRCm39) V139A probably benign Het
Bscl2 A T 19: 8,818,745 (GRCm39) M57L probably damaging Het
C2cd5 A G 6: 142,975,364 (GRCm39) I794T possibly damaging Het
Cacna1s C T 1: 136,012,175 (GRCm39) T539I possibly damaging Het
Capn7 A G 14: 31,076,130 (GRCm39) I311V possibly damaging Het
Cd180 A G 13: 102,839,239 (GRCm39) N41D probably benign Het
Cdin1 T C 2: 115,607,471 (GRCm39) F275L possibly damaging Het
Celsr1 G A 15: 85,823,395 (GRCm39) T1671I probably benign Het
Cep135 A T 5: 76,780,062 (GRCm39) Q798L probably damaging Het
Cfap65 T C 1: 74,971,180 (GRCm39) D46G probably benign Het
Cracd A T 5: 77,006,056 (GRCm39) T806S unknown Het
Ddx46 G T 13: 55,787,748 (GRCm39) probably null Het
Dnah7b T C 1: 46,230,948 (GRCm39) L1402P probably damaging Het
Dnah8 A G 17: 30,929,525 (GRCm39) E1402G probably damaging Het
Dock9 A G 14: 121,784,008 (GRCm39) Y1989H possibly damaging Het
Ereg A G 5: 91,236,323 (GRCm39) D50G probably benign Het
Evi5 G T 5: 107,990,027 (GRCm39) T64K possibly damaging Het
Frem3 A C 8: 81,338,660 (GRCm39) T318P probably damaging Het
Gpx1 A G 9: 108,217,139 (GRCm39) D81G possibly damaging Het
Gramd1a T C 7: 30,833,929 (GRCm39) I499V probably benign Het
H4c12 A T 13: 21,934,375 (GRCm39) F101I probably damaging Het
Herc2 T A 7: 55,758,526 (GRCm39) D804E probably damaging Het
Hk1 T C 10: 62,107,437 (GRCm39) E846G probably damaging Het
Iars2 G A 1: 185,061,342 (GRCm39) A48V probably damaging Het
Invs C T 4: 48,283,278 (GRCm39) T10M possibly damaging Het
Ism2 A T 12: 87,326,975 (GRCm39) D321E probably benign Het
Itpr1 T C 6: 108,448,152 (GRCm39) S231P possibly damaging Het
Kif17 A T 4: 138,005,710 (GRCm39) probably null Het
Lvrn A G 18: 47,023,947 (GRCm39) I765V possibly damaging Het
Map4k4 T A 1: 40,015,882 (GRCm39) C108S probably damaging Het
Mapk13 G T 17: 28,996,535 (GRCm39) probably null Het
Mapkapk2 T A 1: 130,985,740 (GRCm39) K95* probably null Het
Mau2 A T 8: 70,491,947 (GRCm39) probably null Het
Mex3a A G 3: 88,444,084 (GRCm39) T387A probably benign Het
Myo5a T C 9: 75,061,165 (GRCm39) probably null Het
Ncbp3 A T 11: 72,964,300 (GRCm39) M417L possibly damaging Het
Nod2 A C 8: 89,397,086 (GRCm39) E810A possibly damaging Het
Nol3 A T 8: 106,006,207 (GRCm39) E152V probably damaging Het
Obox6 T C 7: 15,567,664 (GRCm39) E261G possibly damaging Het
Or2h1 A T 17: 37,404,058 (GRCm39) L236* probably null Het
Or8b12b A C 9: 37,684,348 (GRCm39) Y131S possibly damaging Het
P3h2 T C 16: 25,924,034 (GRCm39) S134G possibly damaging Het
Plxna2 A T 1: 194,487,222 (GRCm39) R1592S possibly damaging Het
Ppp1r12a C T 10: 108,097,137 (GRCm39) S250L possibly damaging Het
Rab38 A G 7: 88,099,917 (GRCm39) D144G possibly damaging Het
Septin1 T C 7: 126,815,894 (GRCm39) M176V probably benign Het
Spata22 C T 11: 73,236,759 (GRCm39) T355M probably benign Het
Tango6 A G 8: 107,468,706 (GRCm39) N734S probably benign Het
Tbc1d17 C A 7: 44,493,738 (GRCm39) R295L probably damaging Het
Thsd7a G T 6: 12,504,074 (GRCm39) P360Q probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tnnt1 T C 7: 4,510,406 (GRCm39) N239S possibly damaging Het
Tpst1 A T 5: 130,131,279 (GRCm39) M250L probably benign Het
Urb1 T A 16: 90,578,994 (GRCm39) D689V possibly damaging Het
Usp28 T A 9: 48,911,730 (GRCm39) probably null Het
Vldlr G A 19: 27,225,370 (GRCm39) D816N probably damaging Het
Vmn1r257 T A 7: 22,391,142 (GRCm39) M201L probably benign Het
Wdr1 A G 5: 38,687,374 (GRCm39) V219A probably damaging Het
Xndc1 T C 7: 101,722,476 (GRCm39) V47A possibly damaging Het
Zfp366 C T 13: 99,365,015 (GRCm39) P59S possibly damaging Het
Zfp366 A G 13: 99,382,685 (GRCm39) E616G possibly damaging Het
Zfp937 T A 2: 150,081,266 (GRCm39) I432K probably benign Het
Other mutations in Cand1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cand1 APN 10 119,047,040 (GRCm39) missense probably benign 0.00
IGL00917:Cand1 APN 10 119,046,841 (GRCm39) missense possibly damaging 0.87
IGL01383:Cand1 APN 10 119,044,072 (GRCm39) missense probably damaging 0.96
IGL02016:Cand1 APN 10 119,048,473 (GRCm39) missense probably damaging 0.98
IGL02271:Cand1 APN 10 119,047,626 (GRCm39) missense probably damaging 1.00
IGL02282:Cand1 APN 10 119,046,614 (GRCm39) missense probably benign 0.26
IGL02494:Cand1 APN 10 119,049,522 (GRCm39) missense probably benign
IGL02527:Cand1 APN 10 119,042,712 (GRCm39) missense probably damaging 1.00
IGL02675:Cand1 APN 10 119,055,602 (GRCm39) missense probably damaging 0.99
IGL02796:Cand1 UTSW 10 119,049,543 (GRCm39) missense probably damaging 1.00
R0114:Cand1 UTSW 10 119,052,427 (GRCm39) missense probably benign
R0667:Cand1 UTSW 10 119,052,425 (GRCm39) missense probably benign 0.00
R1589:Cand1 UTSW 10 119,049,471 (GRCm39) missense probably damaging 0.97
R1591:Cand1 UTSW 10 119,047,774 (GRCm39) missense possibly damaging 0.63
R1626:Cand1 UTSW 10 119,045,919 (GRCm39) missense possibly damaging 0.46
R1771:Cand1 UTSW 10 119,044,211 (GRCm39) missense probably benign 0.05
R1937:Cand1 UTSW 10 119,038,925 (GRCm39) missense probably damaging 1.00
R1951:Cand1 UTSW 10 119,043,925 (GRCm39) splice site probably benign
R1990:Cand1 UTSW 10 119,045,972 (GRCm39) missense probably damaging 1.00
R3522:Cand1 UTSW 10 119,075,102 (GRCm39) missense probably benign 0.01
R4207:Cand1 UTSW 10 119,047,750 (GRCm39) missense probably damaging 1.00
R4209:Cand1 UTSW 10 119,047,463 (GRCm39) missense probably benign 0.24
R4502:Cand1 UTSW 10 119,052,572 (GRCm39) missense probably benign
R4791:Cand1 UTSW 10 119,046,607 (GRCm39) missense probably benign 0.02
R4841:Cand1 UTSW 10 119,049,451 (GRCm39) critical splice donor site probably null
R4842:Cand1 UTSW 10 119,049,451 (GRCm39) critical splice donor site probably null
R5326:Cand1 UTSW 10 119,047,933 (GRCm39) missense probably benign
R5606:Cand1 UTSW 10 119,047,359 (GRCm39) missense possibly damaging 0.63
R5613:Cand1 UTSW 10 119,051,228 (GRCm39) missense possibly damaging 0.93
R5768:Cand1 UTSW 10 119,046,910 (GRCm39) missense probably benign 0.06
R5884:Cand1 UTSW 10 119,049,670 (GRCm39) missense possibly damaging 0.90
R6006:Cand1 UTSW 10 119,045,933 (GRCm39) missense possibly damaging 0.83
R6062:Cand1 UTSW 10 119,053,915 (GRCm39) missense possibly damaging 0.89
R6734:Cand1 UTSW 10 119,047,897 (GRCm39) missense possibly damaging 0.67
R7058:Cand1 UTSW 10 119,047,659 (GRCm39) missense probably benign 0.00
R7342:Cand1 UTSW 10 119,047,692 (GRCm39) missense possibly damaging 0.64
R7425:Cand1 UTSW 10 119,052,148 (GRCm39) missense probably benign 0.00
R7705:Cand1 UTSW 10 119,048,343 (GRCm39) critical splice donor site probably null
R7812:Cand1 UTSW 10 119,053,864 (GRCm39) missense probably benign 0.04
R7916:Cand1 UTSW 10 119,052,493 (GRCm39) missense probably benign 0.00
R7982:Cand1 UTSW 10 119,052,378 (GRCm39) missense probably damaging 0.97
R8117:Cand1 UTSW 10 119,042,721 (GRCm39) missense probably damaging 1.00
R9388:Cand1 UTSW 10 119,047,213 (GRCm39) missense possibly damaging 0.62
Z1176:Cand1 UTSW 10 119,075,099 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTAAGAAAACACAACTTCTGCCTG -3'
(R):5'- GCTAGGTCCTGTTTCCTGAGAG -3'

Sequencing Primer
(F):5'- CCTGATCTACAAAGTGAGTTCCAGG -3'
(R):5'- CCTGTTTCCTGAGAGTTAGAAGACAG -3'
Posted On 2018-10-18