Mutagenetix > Incidental Mutation

Incidental Mutation 'R6838:Cand1'

537970

Institutional Source

Beutler Lab

Gene Symbol

Cand1

Ensembl Gene

ENSMUSG00000020114

Gene Name

cullin associated and neddylation disassociated 1

Synonyms

D10Ertd516e, 2310038O07Rik, 6330512O03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6838 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119199255-119240055 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119210030 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 990 (K990R)

Ref Sequence

ENSEMBL: ENSMUSP00000020315 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020315]

AlphaFold

Q6ZQ38

Predicted Effect

probably benign
Transcript: ENSMUST00000020315
AA Change: K990R

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000020315
Gene: ENSMUSG00000020114
AA Change: K990R

Domain	Start	End	E-Value	Type
SCOP:d1qgra_	53	994	4e-44	SMART
Pfam:TIP120	1040	1203	1.9e-68	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.7%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of Cullin-RING ubiquitin ligases, which are in involved in ubiquitinylation of proteins degraded by the Ub proteasome system. The encoded protein binds to unneddylated cullin-RING box protein complexes and acts as an inhibitor of cullin neddylation and of Skp1, cullin, and F box ubiquitin ligase complex assembly and activity. In mammalian cell culture, this protein predominantly localizes to the cytoplasm. Knockdown of this gene in preadipocytes results in blocked adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Aqp9	T	A	9: 71,112,216	M321L	probably benign	Het
Avil	G	A	10: 127,013,562	D576N	probably benign	Het
Bbs1	C	T	19: 4,903,852	M94I	possibly damaging	Het
BC052040	T	C	2: 115,776,990	F275L	possibly damaging	Het
Bms1	A	G	6: 118,416,494	V139A	probably benign	Het
Bscl2	A	T	19: 8,841,381	M57L	probably damaging	Het
C2cd5	A	G	6: 143,029,638	I794T	possibly damaging	Het
C530008M17Rik	A	T	5: 76,858,209	T806S	unknown	Het
Cacna1s	C	T	1: 136,084,437	T539I	possibly damaging	Het
Capn7	A	G	14: 31,354,173	I311V	possibly damaging	Het
Cd180	A	G	13: 102,702,731	N41D	probably benign	Het
Celsr1	G	A	15: 85,939,194	T1671I	probably benign	Het
Cep135	A	T	5: 76,632,215	Q798L	probably damaging	Het
Cfap65	T	C	1: 74,932,021	D46G	probably benign	Het
Ddx46	G	T	13: 55,639,935		probably null	Het
Dnah7b	T	C	1: 46,191,788	L1402P	probably damaging	Het
Dnah8	A	G	17: 30,710,551	E1402G	probably damaging	Het
Dock9	A	G	14: 121,546,596	Y1989H	possibly damaging	Het
Ereg	A	G	5: 91,088,464	D50G	probably benign	Het
Evi5	G	T	5: 107,842,161	T64K	possibly damaging	Het
Frem3	A	C	8: 80,612,031	T318P	probably damaging	Het
Gm8693	T	A	7: 22,691,717	M201L	probably benign	Het
Gpx1	A	G	9: 108,339,940	D81G	possibly damaging	Het
Gramd1a	T	C	7: 31,134,504	I499V	probably benign	Het
Herc2	T	A	7: 56,108,778	D804E	probably damaging	Het
Hist1h4k	A	T	13: 21,750,205	F101I	probably damaging	Het
Hk1	T	C	10: 62,271,658	E846G	probably damaging	Het
Iars2	G	A	1: 185,329,145	A48V	probably damaging	Het
Invs	C	T	4: 48,283,278	T10M	possibly damaging	Het
Ism2	A	T	12: 87,280,201	D321E	probably benign	Het
Itpr1	T	C	6: 108,471,191	S231P	possibly damaging	Het
Kif17	A	T	4: 138,278,399		probably null	Het
Lvrn	A	G	18: 46,890,880	I765V	possibly damaging	Het
Map4k4	T	A	1: 39,976,722	C108S	probably damaging	Het
Mapk13	G	T	17: 28,777,561		probably null	Het
Mapkapk2	T	A	1: 131,058,003	K95*	probably null	Het
Mau2	A	T	8: 70,039,297		probably null	Het
Mex3a	A	G	3: 88,536,777	T387A	probably benign	Het
Myo5a	T	C	9: 75,153,883		probably null	Het
Ncbp3	A	T	11: 73,073,474	M417L	possibly damaging	Het
Nod2	A	C	8: 88,670,458	E810A	possibly damaging	Het
Nol3	A	T	8: 105,279,575	E152V	probably damaging	Het
Obox6	T	C	7: 15,833,739	E261G	possibly damaging	Het
Olfr875	A	C	9: 37,773,052	Y131S	possibly damaging	Het
Olfr91	A	T	17: 37,093,166	L236*	probably null	Het
P3h2	T	C	16: 26,105,284	S134G	possibly damaging	Het
Plxna2	A	T	1: 194,804,914	R1592S	possibly damaging	Het
Ppp1r12a	C	T	10: 108,261,276	S250L	possibly damaging	Het
Rab38	A	G	7: 88,450,709	D144G	possibly damaging	Het
Sept1	T	C	7: 127,216,722	M176V	probably benign	Het
Spata22	C	T	11: 73,345,933	T355M	probably benign	Het
Tango6	A	G	8: 106,742,074	N734S	probably benign	Het
Tbc1d17	C	A	7: 44,844,314	R295L	probably damaging	Het
Thsd7a	G	T	6: 12,504,075	P360Q	probably damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tnnt1	T	C	7: 4,507,407	N239S	possibly damaging	Het
Tpst1	A	T	5: 130,102,438	M250L	probably benign	Het
Urb1	T	A	16: 90,782,106	D689V	possibly damaging	Het
Usp28	T	A	9: 49,000,430		probably null	Het
Vldlr	G	A	19: 27,247,970	D816N	probably damaging	Het
Wdr1	A	G	5: 38,530,031	V219A	probably damaging	Het
Xndc1	T	C	7: 102,073,269	V47A	possibly damaging	Het
Zfp366	C	T	13: 99,228,507	P59S	possibly damaging	Het
Zfp366	A	G	13: 99,246,177	E616G	possibly damaging	Het
Zfp937	T	A	2: 150,239,346	I432K	probably benign	Het

Other mutations in Cand1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Cand1	APN	10	119211135	missense	probably benign	0.00
IGL00917:Cand1	APN	10	119210936	missense	possibly damaging	0.87
IGL01383:Cand1	APN	10	119208167	missense	probably damaging	0.96
IGL02016:Cand1	APN	10	119212568	missense	probably damaging	0.98
IGL02271:Cand1	APN	10	119211721	missense	probably damaging	1.00
IGL02282:Cand1	APN	10	119210709	missense	probably benign	0.26
IGL02494:Cand1	APN	10	119213617	missense	probably benign
IGL02527:Cand1	APN	10	119206807	missense	probably damaging	1.00
IGL02675:Cand1	APN	10	119219697	missense	probably damaging	0.99
IGL02796:Cand1	UTSW	10	119213638	missense	probably damaging	1.00
R0114:Cand1	UTSW	10	119216522	missense	probably benign
R0667:Cand1	UTSW	10	119216520	missense	probably benign	0.00
R1589:Cand1	UTSW	10	119213566	missense	probably damaging	0.97
R1591:Cand1	UTSW	10	119211869	missense	possibly damaging	0.63
R1626:Cand1	UTSW	10	119210014	missense	possibly damaging	0.46
R1771:Cand1	UTSW	10	119208306	missense	probably benign	0.05
R1937:Cand1	UTSW	10	119203020	missense	probably damaging	1.00
R1951:Cand1	UTSW	10	119208020	splice site	probably benign
R1990:Cand1	UTSW	10	119210067	missense	probably damaging	1.00
R3522:Cand1	UTSW	10	119239197	missense	probably benign	0.01
R4207:Cand1	UTSW	10	119211845	missense	probably damaging	1.00
R4209:Cand1	UTSW	10	119211558	missense	probably benign	0.24
R4502:Cand1	UTSW	10	119216667	missense	probably benign
R4791:Cand1	UTSW	10	119210702	missense	probably benign	0.02
R4841:Cand1	UTSW	10	119213546	critical splice donor site	probably null
R4842:Cand1	UTSW	10	119213546	critical splice donor site	probably null
R5326:Cand1	UTSW	10	119212028	missense	probably benign
R5606:Cand1	UTSW	10	119211454	missense	possibly damaging	0.63
R5613:Cand1	UTSW	10	119215323	missense	possibly damaging	0.93
R5768:Cand1	UTSW	10	119211005	missense	probably benign	0.06
R5884:Cand1	UTSW	10	119213765	missense	possibly damaging	0.90
R6006:Cand1	UTSW	10	119210028	missense	possibly damaging	0.83
R6062:Cand1	UTSW	10	119218010	missense	possibly damaging	0.89
R6734:Cand1	UTSW	10	119211992	missense	possibly damaging	0.67
R7058:Cand1	UTSW	10	119211754	missense	probably benign	0.00
R7342:Cand1	UTSW	10	119211787	missense	possibly damaging	0.64
R7425:Cand1	UTSW	10	119216243	missense	probably benign	0.00
R7705:Cand1	UTSW	10	119212438	critical splice donor site	probably null
R7812:Cand1	UTSW	10	119217959	missense	probably benign	0.04
R7916:Cand1	UTSW	10	119216588	missense	probably benign	0.00
R7982:Cand1	UTSW	10	119216473	missense	probably damaging	0.97
R8117:Cand1	UTSW	10	119206816	missense	probably damaging	1.00
R9388:Cand1	UTSW	10	119211308	missense	possibly damaging	0.62
Z1176:Cand1	UTSW	10	119239194	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTAAGAAAACACAACTTCTGCCTG -3'
(R):5'- GCTAGGTCCTGTTTCCTGAGAG -3'

Sequencing Primer
(F):5'- CCTGATCTACAAAGTGAGTTCCAGG -3'
(R):5'- CCTGTTTCCTGAGAGTTAGAAGACAG -3'

Posted On

2018-10-18