Incidental Mutation 'R6838:Ncbp3'
ID537972
Institutional Source Beutler Lab
Gene Symbol Ncbp3
Ensembl Gene ENSMUSG00000020783
Gene Namenuclear cap binding subunit 3
Synonyms1200014J11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6838 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73047783-73089317 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73073474 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 417 (M417L)
Ref Sequence ENSEMBL: ENSMUSP00000021135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021135
AA Change: M417L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021135
Gene: ENSMUSG00000020783
AA Change: M417L

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
low complexity region 33 52 N/A INTRINSIC
Pfam:DUF2414 123 177 4.5e-24 PFAM
low complexity region 191 231 N/A INTRINSIC
coiled coil region 345 364 N/A INTRINSIC
low complexity region 379 403 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 602 615 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Ncbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ncbp3 APN 11 73073529 splice site probably benign
R0180:Ncbp3 UTSW 11 73064978 splice site probably null
R0464:Ncbp3 UTSW 11 73069821 splice site probably benign
R0620:Ncbp3 UTSW 11 73049845 splice site probably benign
R2024:Ncbp3 UTSW 11 73053520 missense possibly damaging 0.95
R2121:Ncbp3 UTSW 11 73053478 missense possibly damaging 0.56
R4610:Ncbp3 UTSW 11 73079018 missense probably damaging 0.98
R4693:Ncbp3 UTSW 11 73075677 missense probably benign 0.00
R4883:Ncbp3 UTSW 11 73069752 missense probably damaging 0.99
R4974:Ncbp3 UTSW 11 73053529 critical splice donor site probably null
R5212:Ncbp3 UTSW 11 73053547 intron probably benign
R5740:Ncbp3 UTSW 11 73053497 missense possibly damaging 0.88
R5906:Ncbp3 UTSW 11 73073501 missense probably benign 0.04
R6026:Ncbp3 UTSW 11 73067722 missense probably benign 0.00
R6154:Ncbp3 UTSW 11 73049874 missense probably damaging 1.00
R6403:Ncbp3 UTSW 11 73078976 missense probably benign 0.00
R6626:Ncbp3 UTSW 11 73073384 missense possibly damaging 0.88
R7155:Ncbp3 UTSW 11 73048009 missense probably damaging 0.99
R7369:Ncbp3 UTSW 11 73077921 missense probably benign 0.00
R7657:Ncbp3 UTSW 11 73073367 missense probably damaging 1.00
Y5379:Ncbp3 UTSW 11 73073260 small deletion probably benign
Z1177:Ncbp3 UTSW 11 73047968 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGATGACAGAGTCGTGGTGG -3'
(R):5'- GCATGGCTTTTAAGAGTTAAGCAT -3'

Sequencing Primer
(F):5'- GAGTACCATGAGGAGCTCCCAG -3'
(R):5'- GGTGCATGACGTTAATTCCAGCAC -3'
Posted On2018-10-18