Incidental Mutation 'R6838:Ism2'
ID537974
Institutional Source Beutler Lab
Gene Symbol Ism2
Ensembl Gene ENSMUSG00000050671
Gene Nameisthmin 2
SynonymsThsd3, LOC217738
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6838 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87278638-87299705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87280201 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 321 (D321E)
Ref Sequence ENSEMBL: ENSMUSP00000117108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051601] [ENSMUST00000125733]
Predicted Effect probably benign
Transcript: ENSMUST00000051601
AA Change: D277E

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000053451
Gene: ENSMUSG00000050671
AA Change: D277E

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
TSP1 206 248 3.9e-7 SMART
AMOP 273 437 1.21e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125733
AA Change: D321E

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117108
Gene: ENSMUSG00000050671
AA Change: D321E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 96 112 N/A INTRINSIC
TSP1 250 292 3.9e-7 SMART
AMOP 317 481 1.21e-75 SMART
Meta Mutation Damage Score 0.1077 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Ism2
AlleleSourceChrCoordTypePredicted EffectPPH Score
canal UTSW 12 87280061 missense probably damaging 1.00
panamin UTSW 12 87286884 splice site probably null
Zone UTSW 12 87299663 missense unknown
PIT4243001:Ism2 UTSW 12 87287058 missense probably benign 0.00
R0544:Ism2 UTSW 12 87285339 missense probably damaging 1.00
R0747:Ism2 UTSW 12 87285398 splice site probably benign
R2258:Ism2 UTSW 12 87280074 missense possibly damaging 0.92
R2859:Ism2 UTSW 12 87299663 missense unknown
R3423:Ism2 UTSW 12 87287097 missense probably benign 0.00
R3425:Ism2 UTSW 12 87287097 missense probably benign 0.00
R4115:Ism2 UTSW 12 87287031 missense probably benign 0.02
R4713:Ism2 UTSW 12 87285027 splice site silent
R4769:Ism2 UTSW 12 87299581 missense probably benign 0.06
R5313:Ism2 UTSW 12 87279762 missense probably damaging 1.00
R5857:Ism2 UTSW 12 87280061 missense probably damaging 1.00
R5984:Ism2 UTSW 12 87287035 missense possibly damaging 0.77
R6389:Ism2 UTSW 12 87282371 missense possibly damaging 0.49
R7019:Ism2 UTSW 12 87299663 missense unknown
R7358:Ism2 UTSW 12 87280040 missense probably damaging 1.00
R7427:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7428:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7777:Ism2 UTSW 12 87286884 splice site probably null
R7824:Ism2 UTSW 12 87279860 missense probably damaging 1.00
R7973:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
Z1177:Ism2 UTSW 12 87280035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGTCCAAGCGCTCTTGTG -3'
(R):5'- GCGGGCTATCCTTTATCTGC -3'

Sequencing Primer
(F):5'- TGTGGGCTACTCGCATCC -3'
(R):5'- CAATTGTGAGCTGCCACATG -3'
Posted On2018-10-18