Incidental Mutation 'R6838:Ddx46'
ID537976
Institutional Source Beutler Lab
Gene Symbol Ddx46
Ensembl Gene ENSMUSG00000021500
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R6838 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55635027-55681256 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 55639935 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099479] [ENSMUST00000172272] [ENSMUST00000223736]
Predicted Effect probably null
Transcript: ENSMUST00000099479
SMART Domains Protein: ENSMUSP00000097078
Gene: ENSMUSG00000021500

DomainStartEndE-ValueType
low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 4e-76 BLAST
DEXDc 391 592 3.27e-49 SMART
HELICc 629 710 1.55e-27 SMART
low complexity region 760 776 N/A INTRINSIC
low complexity region 798 813 N/A INTRINSIC
internal_repeat_1 855 894 6.68e-7 PROSPERO
low complexity region 911 925 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172272
SMART Domains Protein: ENSMUSP00000133245
Gene: ENSMUSG00000021500

DomainStartEndE-ValueType
low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 5e-76 BLAST
DEXDc 391 596 8.03e-67 SMART
HELICc 633 714 1.55e-27 SMART
low complexity region 764 780 N/A INTRINSIC
low complexity region 802 817 N/A INTRINSIC
internal_repeat_1 859 898 1.04e-6 PROSPERO
low complexity region 915 929 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223736
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the 17S U2 snRNP complex; it plays an important role in pre-mRNA splicing. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Ddx46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Ddx46 APN 13 55666332 nonsense probably null
IGL01137:Ddx46 APN 13 55669717 nonsense probably null
IGL01432:Ddx46 APN 13 55638022 splice site probably benign
IGL01575:Ddx46 APN 13 55654183 splice site probably benign
IGL01673:Ddx46 APN 13 55653048 missense probably damaging 1.00
IGL01868:Ddx46 APN 13 55639870 nonsense probably null
IGL01945:Ddx46 APN 13 55655072 nonsense probably null
IGL02106:Ddx46 APN 13 55677603 unclassified probably benign
IGL03288:Ddx46 APN 13 55638094 missense unknown
R0270:Ddx46 UTSW 13 55674104 missense probably benign 0.00
R0631:Ddx46 UTSW 13 55639777 splice site probably benign
R1082:Ddx46 UTSW 13 55655096 missense possibly damaging 0.87
R1502:Ddx46 UTSW 13 55663309 missense possibly damaging 0.89
R2081:Ddx46 UTSW 13 55674016 missense probably benign 0.00
R2256:Ddx46 UTSW 13 55647708 missense possibly damaging 0.50
R4366:Ddx46 UTSW 13 55663236 missense probably benign 0.10
R4856:Ddx46 UTSW 13 55638199 missense unknown
R4886:Ddx46 UTSW 13 55638199 missense unknown
R5001:Ddx46 UTSW 13 55652919 missense probably damaging 0.98
R5152:Ddx46 UTSW 13 55659030 missense probably damaging 1.00
R5258:Ddx46 UTSW 13 55653024 missense possibly damaging 0.95
R5278:Ddx46 UTSW 13 55676038 missense probably damaging 0.97
R5806:Ddx46 UTSW 13 55663337 missense possibly damaging 0.93
R6627:Ddx46 UTSW 13 55652935 missense probably benign 0.15
R6659:Ddx46 UTSW 13 55669724 missense probably damaging 1.00
R7235:Ddx46 UTSW 13 55663240 missense probably benign 0.01
R7537:Ddx46 UTSW 13 55650478 missense probably damaging 1.00
R7664:Ddx46 UTSW 13 55659051 missense probably damaging 1.00
R7673:Ddx46 UTSW 13 55659159 missense probably benign 0.01
R7704:Ddx46 UTSW 13 55674019 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTAATTCTCTTTGGCCAC -3'
(R):5'- CAGCATGCCTGAGACAATAGTC -3'

Sequencing Primer
(F):5'- ATTCTCTTTGGCCACAAAATAAAAG -3'
(R):5'- TAGTCACTGCCCCACAAAAGATG -3'
Posted On2018-10-18