Incidental Mutation 'R6838:Zfp366'
ID537979
Institutional Source Beutler Lab
Gene Symbol Zfp366
Ensembl Gene ENSMUSG00000050919
Gene Namezinc finger protein 366
SynonymsDC-SCRIPT
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R6838 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location99184823-99250656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99246177 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 616 (E616G)
Ref Sequence ENSEMBL: ENSMUSP00000060040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056558]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056558
AA Change: E616G

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060040
Gene: ENSMUSG00000050919
AA Change: E616G

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
ZnF_C2H2 250 272 1.18e-2 SMART
ZnF_C2H2 278 300 4.05e-1 SMART
ZnF_C2H2 306 328 1.79e-2 SMART
ZnF_C2H2 334 356 1.53e-1 SMART
ZnF_C2H2 362 384 1.89e-1 SMART
ZnF_C2H2 390 412 1.22e-4 SMART
ZnF_C2H2 418 440 1.36e-2 SMART
ZnF_C2H2 446 468 1.1e-2 SMART
ZnF_C2H2 474 496 8.34e-3 SMART
ZnF_C2H2 502 524 5.42e-2 SMART
ZnF_C2H2 530 553 2.4e-3 SMART
low complexity region 615 623 N/A INTRINSIC
Meta Mutation Damage Score 0.2579 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit perimembranous and muscular ventricular septal defects (VSD), and overriding aorta. Short snout, micrognathia, micropthalmia, hypoplastic thymus, and hydronephrosis are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Zfp366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Zfp366 APN 13 99246572 utr 3 prime probably benign
IGL01626:Zfp366 APN 13 99228412 missense probably damaging 0.99
IGL02227:Zfp366 APN 13 99234188 missense possibly damaging 0.85
IGL03074:Zfp366 APN 13 99246405 missense probably benign
R0126:Zfp366 UTSW 13 99228621 missense probably benign 0.14
R0145:Zfp366 UTSW 13 99229540 missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99234260 missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99234260 missense probably damaging 1.00
R0376:Zfp366 UTSW 13 99234251 missense probably benign 0.00
R0537:Zfp366 UTSW 13 99229278 missense probably damaging 1.00
R0637:Zfp366 UTSW 13 99228966 missense probably damaging 0.99
R0838:Zfp366 UTSW 13 99228610 missense possibly damaging 0.73
R1386:Zfp366 UTSW 13 99246555 missense probably damaging 0.98
R1422:Zfp366 UTSW 13 99229296 missense probably damaging 1.00
R1669:Zfp366 UTSW 13 99229561 missense probably damaging 0.99
R1839:Zfp366 UTSW 13 99228492 missense probably damaging 0.98
R3751:Zfp366 UTSW 13 99228844 missense probably damaging 1.00
R4782:Zfp366 UTSW 13 99246483 missense probably damaging 1.00
R4908:Zfp366 UTSW 13 99234101 missense possibly damaging 0.68
R4992:Zfp366 UTSW 13 99229495 missense possibly damaging 0.62
R5040:Zfp366 UTSW 13 99228367 missense probably damaging 1.00
R5086:Zfp366 UTSW 13 99228943 missense probably benign 0.00
R5186:Zfp366 UTSW 13 99246168 missense probably benign 0.00
R5249:Zfp366 UTSW 13 99229609 missense probably damaging 1.00
R5450:Zfp366 UTSW 13 99229585 missense probably damaging 1.00
R6838:Zfp366 UTSW 13 99228507 missense possibly damaging 0.93
R7250:Zfp366 UTSW 13 99229568 missense probably damaging 1.00
R7378:Zfp366 UTSW 13 99229515 missense probably damaging 1.00
R7571:Zfp366 UTSW 13 99246387 missense probably benign 0.03
R7624:Zfp366 UTSW 13 99246296 missense probably benign
R7653:Zfp366 UTSW 13 99229201 missense probably damaging 1.00
R8367:Zfp366 UTSW 13 99244043 missense possibly damaging 0.95
Z1176:Zfp366 UTSW 13 99246350 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATTCTGCTCTGGTCCTGCAG -3'
(R):5'- CCTCGCAGTCTATGTCACTG -3'

Sequencing Primer
(F):5'- CTCTGGTCCTGCAGGTCTG -3'
(R):5'- ATGTCACTGCCCTCGTGG -3'
Posted On2018-10-18