Incidental Mutation 'R6838:Zfp366'
ID 537979
Institutional Source Beutler Lab
Gene Symbol Zfp366
Ensembl Gene ENSMUSG00000050919
Gene Name zinc finger protein 366
Synonyms DC-SCRIPT
MMRRC Submission 044946-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.277) question?
Stock # R6838 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 99321331-99383540 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99382685 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 616 (E616G)
Ref Sequence ENSEMBL: ENSMUSP00000060040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056558]
AlphaFold Q6NS86
Predicted Effect possibly damaging
Transcript: ENSMUST00000056558
AA Change: E616G

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060040
Gene: ENSMUSG00000050919
AA Change: E616G

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
ZnF_C2H2 250 272 1.18e-2 SMART
ZnF_C2H2 278 300 4.05e-1 SMART
ZnF_C2H2 306 328 1.79e-2 SMART
ZnF_C2H2 334 356 1.53e-1 SMART
ZnF_C2H2 362 384 1.89e-1 SMART
ZnF_C2H2 390 412 1.22e-4 SMART
ZnF_C2H2 418 440 1.36e-2 SMART
ZnF_C2H2 446 468 1.1e-2 SMART
ZnF_C2H2 474 496 8.34e-3 SMART
ZnF_C2H2 502 524 5.42e-2 SMART
ZnF_C2H2 530 553 2.4e-3 SMART
low complexity region 615 623 N/A INTRINSIC
Meta Mutation Damage Score 0.2579 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit perimembranous and muscular ventricular septal defects (VSD), and overriding aorta. Short snout, micrognathia, micropthalmia, hypoplastic thymus, and hydronephrosis are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,291,546 (GRCm39) T317R probably damaging Het
Aqp9 T A 9: 71,019,498 (GRCm39) M321L probably benign Het
Avil G A 10: 126,849,431 (GRCm39) D576N probably benign Het
Bbs1 C T 19: 4,953,880 (GRCm39) M94I possibly damaging Het
Bms1 A G 6: 118,393,455 (GRCm39) V139A probably benign Het
Bscl2 A T 19: 8,818,745 (GRCm39) M57L probably damaging Het
C2cd5 A G 6: 142,975,364 (GRCm39) I794T possibly damaging Het
Cacna1s C T 1: 136,012,175 (GRCm39) T539I possibly damaging Het
Cand1 T C 10: 119,045,935 (GRCm39) K990R probably benign Het
Capn7 A G 14: 31,076,130 (GRCm39) I311V possibly damaging Het
Cd180 A G 13: 102,839,239 (GRCm39) N41D probably benign Het
Cdin1 T C 2: 115,607,471 (GRCm39) F275L possibly damaging Het
Celsr1 G A 15: 85,823,395 (GRCm39) T1671I probably benign Het
Cep135 A T 5: 76,780,062 (GRCm39) Q798L probably damaging Het
Cfap65 T C 1: 74,971,180 (GRCm39) D46G probably benign Het
Cracd A T 5: 77,006,056 (GRCm39) T806S unknown Het
Ddx46 G T 13: 55,787,748 (GRCm39) probably null Het
Dnah7b T C 1: 46,230,948 (GRCm39) L1402P probably damaging Het
Dnah8 A G 17: 30,929,525 (GRCm39) E1402G probably damaging Het
Dock9 A G 14: 121,784,008 (GRCm39) Y1989H possibly damaging Het
Ereg A G 5: 91,236,323 (GRCm39) D50G probably benign Het
Evi5 G T 5: 107,990,027 (GRCm39) T64K possibly damaging Het
Frem3 A C 8: 81,338,660 (GRCm39) T318P probably damaging Het
Gpx1 A G 9: 108,217,139 (GRCm39) D81G possibly damaging Het
Gramd1a T C 7: 30,833,929 (GRCm39) I499V probably benign Het
H4c12 A T 13: 21,934,375 (GRCm39) F101I probably damaging Het
Herc2 T A 7: 55,758,526 (GRCm39) D804E probably damaging Het
Hk1 T C 10: 62,107,437 (GRCm39) E846G probably damaging Het
Iars2 G A 1: 185,061,342 (GRCm39) A48V probably damaging Het
Invs C T 4: 48,283,278 (GRCm39) T10M possibly damaging Het
Ism2 A T 12: 87,326,975 (GRCm39) D321E probably benign Het
Itpr1 T C 6: 108,448,152 (GRCm39) S231P possibly damaging Het
Kif17 A T 4: 138,005,710 (GRCm39) probably null Het
Lvrn A G 18: 47,023,947 (GRCm39) I765V possibly damaging Het
Map4k4 T A 1: 40,015,882 (GRCm39) C108S probably damaging Het
Mapk13 G T 17: 28,996,535 (GRCm39) probably null Het
Mapkapk2 T A 1: 130,985,740 (GRCm39) K95* probably null Het
Mau2 A T 8: 70,491,947 (GRCm39) probably null Het
Mex3a A G 3: 88,444,084 (GRCm39) T387A probably benign Het
Myo5a T C 9: 75,061,165 (GRCm39) probably null Het
Ncbp3 A T 11: 72,964,300 (GRCm39) M417L possibly damaging Het
Nod2 A C 8: 89,397,086 (GRCm39) E810A possibly damaging Het
Nol3 A T 8: 106,006,207 (GRCm39) E152V probably damaging Het
Obox6 T C 7: 15,567,664 (GRCm39) E261G possibly damaging Het
Or2h1 A T 17: 37,404,058 (GRCm39) L236* probably null Het
Or8b12b A C 9: 37,684,348 (GRCm39) Y131S possibly damaging Het
P3h2 T C 16: 25,924,034 (GRCm39) S134G possibly damaging Het
Plxna2 A T 1: 194,487,222 (GRCm39) R1592S possibly damaging Het
Ppp1r12a C T 10: 108,097,137 (GRCm39) S250L possibly damaging Het
Rab38 A G 7: 88,099,917 (GRCm39) D144G possibly damaging Het
Septin1 T C 7: 126,815,894 (GRCm39) M176V probably benign Het
Spata22 C T 11: 73,236,759 (GRCm39) T355M probably benign Het
Tango6 A G 8: 107,468,706 (GRCm39) N734S probably benign Het
Tbc1d17 C A 7: 44,493,738 (GRCm39) R295L probably damaging Het
Thsd7a G T 6: 12,504,074 (GRCm39) P360Q probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tnnt1 T C 7: 4,510,406 (GRCm39) N239S possibly damaging Het
Tpst1 A T 5: 130,131,279 (GRCm39) M250L probably benign Het
Urb1 T A 16: 90,578,994 (GRCm39) D689V possibly damaging Het
Usp28 T A 9: 48,911,730 (GRCm39) probably null Het
Vldlr G A 19: 27,225,370 (GRCm39) D816N probably damaging Het
Vmn1r257 T A 7: 22,391,142 (GRCm39) M201L probably benign Het
Wdr1 A G 5: 38,687,374 (GRCm39) V219A probably damaging Het
Xndc1 T C 7: 101,722,476 (GRCm39) V47A possibly damaging Het
Zfp937 T A 2: 150,081,266 (GRCm39) I432K probably benign Het
Other mutations in Zfp366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Zfp366 APN 13 99,383,080 (GRCm39) utr 3 prime probably benign
IGL01626:Zfp366 APN 13 99,364,920 (GRCm39) missense probably damaging 0.99
IGL02227:Zfp366 APN 13 99,370,696 (GRCm39) missense possibly damaging 0.85
IGL03074:Zfp366 APN 13 99,382,913 (GRCm39) missense probably benign
R0126:Zfp366 UTSW 13 99,365,129 (GRCm39) missense probably benign 0.14
R0145:Zfp366 UTSW 13 99,366,048 (GRCm39) missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99,370,768 (GRCm39) missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99,370,768 (GRCm39) missense probably damaging 1.00
R0376:Zfp366 UTSW 13 99,370,759 (GRCm39) missense probably benign 0.00
R0537:Zfp366 UTSW 13 99,365,786 (GRCm39) missense probably damaging 1.00
R0637:Zfp366 UTSW 13 99,365,474 (GRCm39) missense probably damaging 0.99
R0838:Zfp366 UTSW 13 99,365,118 (GRCm39) missense possibly damaging 0.73
R1386:Zfp366 UTSW 13 99,383,063 (GRCm39) missense probably damaging 0.98
R1422:Zfp366 UTSW 13 99,365,804 (GRCm39) missense probably damaging 1.00
R1669:Zfp366 UTSW 13 99,366,069 (GRCm39) missense probably damaging 0.99
R1839:Zfp366 UTSW 13 99,365,000 (GRCm39) missense probably damaging 0.98
R3751:Zfp366 UTSW 13 99,365,352 (GRCm39) missense probably damaging 1.00
R4782:Zfp366 UTSW 13 99,382,991 (GRCm39) missense probably damaging 1.00
R4908:Zfp366 UTSW 13 99,370,609 (GRCm39) missense possibly damaging 0.68
R4992:Zfp366 UTSW 13 99,366,003 (GRCm39) missense possibly damaging 0.62
R5040:Zfp366 UTSW 13 99,364,875 (GRCm39) missense probably damaging 1.00
R5086:Zfp366 UTSW 13 99,365,451 (GRCm39) missense probably benign 0.00
R5186:Zfp366 UTSW 13 99,382,676 (GRCm39) missense probably benign 0.00
R5249:Zfp366 UTSW 13 99,366,117 (GRCm39) missense probably damaging 1.00
R5450:Zfp366 UTSW 13 99,366,093 (GRCm39) missense probably damaging 1.00
R6838:Zfp366 UTSW 13 99,365,015 (GRCm39) missense possibly damaging 0.93
R7250:Zfp366 UTSW 13 99,366,076 (GRCm39) missense probably damaging 1.00
R7378:Zfp366 UTSW 13 99,366,023 (GRCm39) missense probably damaging 1.00
R7571:Zfp366 UTSW 13 99,382,895 (GRCm39) missense probably benign 0.03
R7624:Zfp366 UTSW 13 99,382,804 (GRCm39) missense probably benign
R7653:Zfp366 UTSW 13 99,365,709 (GRCm39) missense probably damaging 1.00
R8367:Zfp366 UTSW 13 99,380,551 (GRCm39) missense possibly damaging 0.95
R9510:Zfp366 UTSW 13 99,365,874 (GRCm39) missense probably damaging 1.00
R9658:Zfp366 UTSW 13 99,365,435 (GRCm39) missense probably benign 0.13
R9734:Zfp366 UTSW 13 99,365,352 (GRCm39) missense probably damaging 1.00
Z1176:Zfp366 UTSW 13 99,382,858 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATTCTGCTCTGGTCCTGCAG -3'
(R):5'- CCTCGCAGTCTATGTCACTG -3'

Sequencing Primer
(F):5'- CTCTGGTCCTGCAGGTCTG -3'
(R):5'- ATGTCACTGCCCTCGTGG -3'
Posted On 2018-10-18