Incidental Mutation 'R6838:Dock9'
ID 537982
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission 044946-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6838 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121784008 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1989 (Y1989H)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000040700
AA Change: Y2014H

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: Y2014H

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
AA Change: Y1959H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: Y1959H

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212181
AA Change: Y1989H

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: Y1981H

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,291,546 (GRCm39) T317R probably damaging Het
Aqp9 T A 9: 71,019,498 (GRCm39) M321L probably benign Het
Avil G A 10: 126,849,431 (GRCm39) D576N probably benign Het
Bbs1 C T 19: 4,953,880 (GRCm39) M94I possibly damaging Het
Bms1 A G 6: 118,393,455 (GRCm39) V139A probably benign Het
Bscl2 A T 19: 8,818,745 (GRCm39) M57L probably damaging Het
C2cd5 A G 6: 142,975,364 (GRCm39) I794T possibly damaging Het
Cacna1s C T 1: 136,012,175 (GRCm39) T539I possibly damaging Het
Cand1 T C 10: 119,045,935 (GRCm39) K990R probably benign Het
Capn7 A G 14: 31,076,130 (GRCm39) I311V possibly damaging Het
Cd180 A G 13: 102,839,239 (GRCm39) N41D probably benign Het
Cdin1 T C 2: 115,607,471 (GRCm39) F275L possibly damaging Het
Celsr1 G A 15: 85,823,395 (GRCm39) T1671I probably benign Het
Cep135 A T 5: 76,780,062 (GRCm39) Q798L probably damaging Het
Cfap65 T C 1: 74,971,180 (GRCm39) D46G probably benign Het
Cracd A T 5: 77,006,056 (GRCm39) T806S unknown Het
Ddx46 G T 13: 55,787,748 (GRCm39) probably null Het
Dnah7b T C 1: 46,230,948 (GRCm39) L1402P probably damaging Het
Dnah8 A G 17: 30,929,525 (GRCm39) E1402G probably damaging Het
Ereg A G 5: 91,236,323 (GRCm39) D50G probably benign Het
Evi5 G T 5: 107,990,027 (GRCm39) T64K possibly damaging Het
Frem3 A C 8: 81,338,660 (GRCm39) T318P probably damaging Het
Gpx1 A G 9: 108,217,139 (GRCm39) D81G possibly damaging Het
Gramd1a T C 7: 30,833,929 (GRCm39) I499V probably benign Het
H4c12 A T 13: 21,934,375 (GRCm39) F101I probably damaging Het
Herc2 T A 7: 55,758,526 (GRCm39) D804E probably damaging Het
Hk1 T C 10: 62,107,437 (GRCm39) E846G probably damaging Het
Iars2 G A 1: 185,061,342 (GRCm39) A48V probably damaging Het
Invs C T 4: 48,283,278 (GRCm39) T10M possibly damaging Het
Ism2 A T 12: 87,326,975 (GRCm39) D321E probably benign Het
Itpr1 T C 6: 108,448,152 (GRCm39) S231P possibly damaging Het
Kif17 A T 4: 138,005,710 (GRCm39) probably null Het
Lvrn A G 18: 47,023,947 (GRCm39) I765V possibly damaging Het
Map4k4 T A 1: 40,015,882 (GRCm39) C108S probably damaging Het
Mapk13 G T 17: 28,996,535 (GRCm39) probably null Het
Mapkapk2 T A 1: 130,985,740 (GRCm39) K95* probably null Het
Mau2 A T 8: 70,491,947 (GRCm39) probably null Het
Mex3a A G 3: 88,444,084 (GRCm39) T387A probably benign Het
Myo5a T C 9: 75,061,165 (GRCm39) probably null Het
Ncbp3 A T 11: 72,964,300 (GRCm39) M417L possibly damaging Het
Nod2 A C 8: 89,397,086 (GRCm39) E810A possibly damaging Het
Nol3 A T 8: 106,006,207 (GRCm39) E152V probably damaging Het
Obox6 T C 7: 15,567,664 (GRCm39) E261G possibly damaging Het
Or2h1 A T 17: 37,404,058 (GRCm39) L236* probably null Het
Or8b12b A C 9: 37,684,348 (GRCm39) Y131S possibly damaging Het
P3h2 T C 16: 25,924,034 (GRCm39) S134G possibly damaging Het
Plxna2 A T 1: 194,487,222 (GRCm39) R1592S possibly damaging Het
Ppp1r12a C T 10: 108,097,137 (GRCm39) S250L possibly damaging Het
Rab38 A G 7: 88,099,917 (GRCm39) D144G possibly damaging Het
Septin1 T C 7: 126,815,894 (GRCm39) M176V probably benign Het
Spata22 C T 11: 73,236,759 (GRCm39) T355M probably benign Het
Tango6 A G 8: 107,468,706 (GRCm39) N734S probably benign Het
Tbc1d17 C A 7: 44,493,738 (GRCm39) R295L probably damaging Het
Thsd7a G T 6: 12,504,074 (GRCm39) P360Q probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tnnt1 T C 7: 4,510,406 (GRCm39) N239S possibly damaging Het
Tpst1 A T 5: 130,131,279 (GRCm39) M250L probably benign Het
Urb1 T A 16: 90,578,994 (GRCm39) D689V possibly damaging Het
Usp28 T A 9: 48,911,730 (GRCm39) probably null Het
Vldlr G A 19: 27,225,370 (GRCm39) D816N probably damaging Het
Vmn1r257 T A 7: 22,391,142 (GRCm39) M201L probably benign Het
Wdr1 A G 5: 38,687,374 (GRCm39) V219A probably damaging Het
Xndc1 T C 7: 101,722,476 (GRCm39) V47A possibly damaging Het
Zfp366 C T 13: 99,365,015 (GRCm39) P59S possibly damaging Het
Zfp366 A G 13: 99,382,685 (GRCm39) E616G possibly damaging Het
Zfp937 T A 2: 150,081,266 (GRCm39) I432K probably benign Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTCTCTTGAACCAGAACAG -3'
(R):5'- GATCCTGACTGACTTGCTTAAACAG -3'

Sequencing Primer
(F):5'- CTCTTGAACCAGAACAGTGCTATGG -3'
(R):5'- TAAACAGCCTTTGGACTCCATGG -3'
Posted On 2018-10-18