Mutagenetix > Incidental Mutation

Incidental Mutation 'R6838:P3h2'

537984

Institutional Source

Beutler Lab

Gene Symbol

P3h2

Ensembl Gene

ENSMUSG00000038168

Gene Name

prolyl 3-hydroxylase 2

Synonyms

Leprel1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6838 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25959288-26105784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26105284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 134 (S134G)

Ref Sequence

ENSEMBL: ENSMUSP00000038056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039990]

AlphaFold

Q8CG71

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039990
AA Change: S134G

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: S134G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	27	36	N/A	INTRINSIC
Pfam:TPR_2	42	73	2.5e-5	PFAM
low complexity region	81	104	N/A	INTRINSIC
low complexity region	114	123	N/A	INTRINSIC
Pfam:TPR_2	206	237	1.2e-5	PFAM
low complexity region	253	266	N/A	INTRINSIC
internal_repeat_1	304	366	4.75e-7	PROSPERO
P4Hc	457	665	1.45e-51	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.7%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Aqp9	T	A	9: 71,112,216	M321L	probably benign	Het
Avil	G	A	10: 127,013,562	D576N	probably benign	Het
Bbs1	C	T	19: 4,903,852	M94I	possibly damaging	Het
BC052040	T	C	2: 115,776,990	F275L	possibly damaging	Het
Bms1	A	G	6: 118,416,494	V139A	probably benign	Het
Bscl2	A	T	19: 8,841,381	M57L	probably damaging	Het
C2cd5	A	G	6: 143,029,638	I794T	possibly damaging	Het
C530008M17Rik	A	T	5: 76,858,209	T806S	unknown	Het
Cacna1s	C	T	1: 136,084,437	T539I	possibly damaging	Het
Cand1	T	C	10: 119,210,030	K990R	probably benign	Het
Capn7	A	G	14: 31,354,173	I311V	possibly damaging	Het
Cd180	A	G	13: 102,702,731	N41D	probably benign	Het
Celsr1	G	A	15: 85,939,194	T1671I	probably benign	Het
Cep135	A	T	5: 76,632,215	Q798L	probably damaging	Het
Cfap65	T	C	1: 74,932,021	D46G	probably benign	Het
Ddx46	G	T	13: 55,639,935		probably null	Het
Dnah7b	T	C	1: 46,191,788	L1402P	probably damaging	Het
Dnah8	A	G	17: 30,710,551	E1402G	probably damaging	Het
Dock9	A	G	14: 121,546,596	Y1989H	possibly damaging	Het
Ereg	A	G	5: 91,088,464	D50G	probably benign	Het
Evi5	G	T	5: 107,842,161	T64K	possibly damaging	Het
Frem3	A	C	8: 80,612,031	T318P	probably damaging	Het
Gm8693	T	A	7: 22,691,717	M201L	probably benign	Het
Gpx1	A	G	9: 108,339,940	D81G	possibly damaging	Het
Gramd1a	T	C	7: 31,134,504	I499V	probably benign	Het
Herc2	T	A	7: 56,108,778	D804E	probably damaging	Het
Hist1h4k	A	T	13: 21,750,205	F101I	probably damaging	Het
Hk1	T	C	10: 62,271,658	E846G	probably damaging	Het
Iars2	G	A	1: 185,329,145	A48V	probably damaging	Het
Invs	C	T	4: 48,283,278	T10M	possibly damaging	Het
Ism2	A	T	12: 87,280,201	D321E	probably benign	Het
Itpr1	T	C	6: 108,471,191	S231P	possibly damaging	Het
Kif17	A	T	4: 138,278,399		probably null	Het
Lvrn	A	G	18: 46,890,880	I765V	possibly damaging	Het
Map4k4	T	A	1: 39,976,722	C108S	probably damaging	Het
Mapk13	G	T	17: 28,777,561		probably null	Het
Mapkapk2	T	A	1: 131,058,003	K95*	probably null	Het
Mau2	A	T	8: 70,039,297		probably null	Het
Mex3a	A	G	3: 88,536,777	T387A	probably benign	Het
Myo5a	T	C	9: 75,153,883		probably null	Het
Ncbp3	A	T	11: 73,073,474	M417L	possibly damaging	Het
Nod2	A	C	8: 88,670,458	E810A	possibly damaging	Het
Nol3	A	T	8: 105,279,575	E152V	probably damaging	Het
Obox6	T	C	7: 15,833,739	E261G	possibly damaging	Het
Olfr875	A	C	9: 37,773,052	Y131S	possibly damaging	Het
Olfr91	A	T	17: 37,093,166	L236*	probably null	Het
Plxna2	A	T	1: 194,804,914	R1592S	possibly damaging	Het
Ppp1r12a	C	T	10: 108,261,276	S250L	possibly damaging	Het
Rab38	A	G	7: 88,450,709	D144G	possibly damaging	Het
Sept1	T	C	7: 127,216,722	M176V	probably benign	Het
Spata22	C	T	11: 73,345,933	T355M	probably benign	Het
Tango6	A	G	8: 106,742,074	N734S	probably benign	Het
Tbc1d17	C	A	7: 44,844,314	R295L	probably damaging	Het
Thsd7a	G	T	6: 12,504,075	P360Q	probably damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tnnt1	T	C	7: 4,507,407	N239S	possibly damaging	Het
Tpst1	A	T	5: 130,102,438	M250L	probably benign	Het
Urb1	T	A	16: 90,782,106	D689V	possibly damaging	Het
Usp28	T	A	9: 49,000,430		probably null	Het
Vldlr	G	A	19: 27,247,970	D816N	probably damaging	Het
Wdr1	A	G	5: 38,530,031	V219A	probably damaging	Het
Xndc1	T	C	7: 102,073,269	V47A	possibly damaging	Het
Zfp366	C	T	13: 99,228,507	P59S	possibly damaging	Het
Zfp366	A	G	13: 99,246,177	E616G	possibly damaging	Het
Zfp937	T	A	2: 150,239,346	I432K	probably benign	Het

Other mutations in P3h2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:P3h2	APN	16	25992798	missense	probably damaging	1.00
IGL01012:P3h2	APN	16	25987248	missense	probably damaging	0.98
IGL02393:P3h2	APN	16	25992825	missense	probably damaging	1.00
IGL02436:P3h2	APN	16	25997200	missense	probably benign	0.01
PIT4445001:P3h2	UTSW	16	25984999	missense	probably benign	0.01
R0319:P3h2	UTSW	16	25970931	missense	possibly damaging	0.93
R0403:P3h2	UTSW	16	25969950	missense	possibly damaging	0.63
R0962:P3h2	UTSW	16	25997248	missense	probably benign
R1290:P3h2	UTSW	16	25987203	missense	probably damaging	0.99
R1300:P3h2	UTSW	16	25997236	nonsense	probably null
R1467:P3h2	UTSW	16	25965868	splice site	probably benign
R1643:P3h2	UTSW	16	25972291	missense	probably benign	0.00
R1645:P3h2	UTSW	16	25997232	missense	probably damaging	1.00
R1761:P3h2	UTSW	16	25985050	missense	probably damaging	0.96
R4227:P3h2	UTSW	16	26105453	missense	probably benign
R4273:P3h2	UTSW	16	26105221	missense	probably benign	0.00
R4409:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4410:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4653:P3h2	UTSW	16	26105277	missense	probably damaging	0.98
R4968:P3h2	UTSW	16	25992662	critical splice donor site	probably null
R5190:P3h2	UTSW	16	25984949	missense	possibly damaging	0.86
R6113:P3h2	UTSW	16	25981153	missense	probably benign	0.01
R6225:P3h2	UTSW	16	25965743	missense	probably damaging	0.97
R6881:P3h2	UTSW	16	25992745	missense	probably damaging	1.00
R7089:P3h2	UTSW	16	25965809	missense	probably damaging	1.00
R7445:P3h2	UTSW	16	25985065	missense	probably damaging	0.96
R7753:P3h2	UTSW	16	25970937	missense	probably damaging	1.00
R8166:P3h2	UTSW	16	25992822	missense	possibly damaging	0.89
R8363:P3h2	UTSW	16	25992718	missense	probably damaging	0.98
R8442:P3h2	UTSW	16	25987205	missense	probably benign	0.05
R8812:P3h2	UTSW	16	25982717	missense	possibly damaging	0.67
R8965:P3h2	UTSW	16	25972384	missense	probably benign	0.41
R9187:P3h2	UTSW	16	26105436	missense	probably benign	0.27
R9193:P3h2	UTSW	16	26105241	missense	probably benign	0.07
R9533:P3h2	UTSW	16	25970975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTACTTGCACGCAAAGCAGAG -3'
(R):5'- ACTACAGCGGCGACTATGAG -3'

Sequencing Primer
(F):5'- AGCCACTGCGAAAGGCTG -3'
(R):5'- ACTATGAGCGAGCGGTGC -3'

Posted On

2018-10-18