Incidental Mutation 'R6838:P3h2'
ID 537984
Institutional Source Beutler Lab
Gene Symbol P3h2
Ensembl Gene ENSMUSG00000038168
Gene Name prolyl 3-hydroxylase 2
Synonyms Leprel1
MMRRC Submission 044946-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6838 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 25778038-25924534 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25924034 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 134 (S134G)
Ref Sequence ENSEMBL: ENSMUSP00000038056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039990]
AlphaFold Q8CG71
Predicted Effect possibly damaging
Transcript: ENSMUST00000039990
AA Change: S134G

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: S134G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 27 36 N/A INTRINSIC
Pfam:TPR_2 42 73 2.5e-5 PFAM
low complexity region 81 104 N/A INTRINSIC
low complexity region 114 123 N/A INTRINSIC
Pfam:TPR_2 206 237 1.2e-5 PFAM
low complexity region 253 266 N/A INTRINSIC
internal_repeat_1 304 366 4.75e-7 PROSPERO
P4Hc 457 665 1.45e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,291,546 (GRCm39) T317R probably damaging Het
Aqp9 T A 9: 71,019,498 (GRCm39) M321L probably benign Het
Avil G A 10: 126,849,431 (GRCm39) D576N probably benign Het
Bbs1 C T 19: 4,953,880 (GRCm39) M94I possibly damaging Het
Bms1 A G 6: 118,393,455 (GRCm39) V139A probably benign Het
Bscl2 A T 19: 8,818,745 (GRCm39) M57L probably damaging Het
C2cd5 A G 6: 142,975,364 (GRCm39) I794T possibly damaging Het
Cacna1s C T 1: 136,012,175 (GRCm39) T539I possibly damaging Het
Cand1 T C 10: 119,045,935 (GRCm39) K990R probably benign Het
Capn7 A G 14: 31,076,130 (GRCm39) I311V possibly damaging Het
Cd180 A G 13: 102,839,239 (GRCm39) N41D probably benign Het
Cdin1 T C 2: 115,607,471 (GRCm39) F275L possibly damaging Het
Celsr1 G A 15: 85,823,395 (GRCm39) T1671I probably benign Het
Cep135 A T 5: 76,780,062 (GRCm39) Q798L probably damaging Het
Cfap65 T C 1: 74,971,180 (GRCm39) D46G probably benign Het
Cracd A T 5: 77,006,056 (GRCm39) T806S unknown Het
Ddx46 G T 13: 55,787,748 (GRCm39) probably null Het
Dnah7b T C 1: 46,230,948 (GRCm39) L1402P probably damaging Het
Dnah8 A G 17: 30,929,525 (GRCm39) E1402G probably damaging Het
Dock9 A G 14: 121,784,008 (GRCm39) Y1989H possibly damaging Het
Ereg A G 5: 91,236,323 (GRCm39) D50G probably benign Het
Evi5 G T 5: 107,990,027 (GRCm39) T64K possibly damaging Het
Frem3 A C 8: 81,338,660 (GRCm39) T318P probably damaging Het
Gpx1 A G 9: 108,217,139 (GRCm39) D81G possibly damaging Het
Gramd1a T C 7: 30,833,929 (GRCm39) I499V probably benign Het
H4c12 A T 13: 21,934,375 (GRCm39) F101I probably damaging Het
Herc2 T A 7: 55,758,526 (GRCm39) D804E probably damaging Het
Hk1 T C 10: 62,107,437 (GRCm39) E846G probably damaging Het
Iars2 G A 1: 185,061,342 (GRCm39) A48V probably damaging Het
Invs C T 4: 48,283,278 (GRCm39) T10M possibly damaging Het
Ism2 A T 12: 87,326,975 (GRCm39) D321E probably benign Het
Itpr1 T C 6: 108,448,152 (GRCm39) S231P possibly damaging Het
Kif17 A T 4: 138,005,710 (GRCm39) probably null Het
Lvrn A G 18: 47,023,947 (GRCm39) I765V possibly damaging Het
Map4k4 T A 1: 40,015,882 (GRCm39) C108S probably damaging Het
Mapk13 G T 17: 28,996,535 (GRCm39) probably null Het
Mapkapk2 T A 1: 130,985,740 (GRCm39) K95* probably null Het
Mau2 A T 8: 70,491,947 (GRCm39) probably null Het
Mex3a A G 3: 88,444,084 (GRCm39) T387A probably benign Het
Myo5a T C 9: 75,061,165 (GRCm39) probably null Het
Ncbp3 A T 11: 72,964,300 (GRCm39) M417L possibly damaging Het
Nod2 A C 8: 89,397,086 (GRCm39) E810A possibly damaging Het
Nol3 A T 8: 106,006,207 (GRCm39) E152V probably damaging Het
Obox6 T C 7: 15,567,664 (GRCm39) E261G possibly damaging Het
Or2h1 A T 17: 37,404,058 (GRCm39) L236* probably null Het
Or8b12b A C 9: 37,684,348 (GRCm39) Y131S possibly damaging Het
Plxna2 A T 1: 194,487,222 (GRCm39) R1592S possibly damaging Het
Ppp1r12a C T 10: 108,097,137 (GRCm39) S250L possibly damaging Het
Rab38 A G 7: 88,099,917 (GRCm39) D144G possibly damaging Het
Septin1 T C 7: 126,815,894 (GRCm39) M176V probably benign Het
Spata22 C T 11: 73,236,759 (GRCm39) T355M probably benign Het
Tango6 A G 8: 107,468,706 (GRCm39) N734S probably benign Het
Tbc1d17 C A 7: 44,493,738 (GRCm39) R295L probably damaging Het
Thsd7a G T 6: 12,504,074 (GRCm39) P360Q probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tnnt1 T C 7: 4,510,406 (GRCm39) N239S possibly damaging Het
Tpst1 A T 5: 130,131,279 (GRCm39) M250L probably benign Het
Urb1 T A 16: 90,578,994 (GRCm39) D689V possibly damaging Het
Usp28 T A 9: 48,911,730 (GRCm39) probably null Het
Vldlr G A 19: 27,225,370 (GRCm39) D816N probably damaging Het
Vmn1r257 T A 7: 22,391,142 (GRCm39) M201L probably benign Het
Wdr1 A G 5: 38,687,374 (GRCm39) V219A probably damaging Het
Xndc1 T C 7: 101,722,476 (GRCm39) V47A possibly damaging Het
Zfp366 C T 13: 99,365,015 (GRCm39) P59S possibly damaging Het
Zfp366 A G 13: 99,382,685 (GRCm39) E616G possibly damaging Het
Zfp937 T A 2: 150,081,266 (GRCm39) I432K probably benign Het
Other mutations in P3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:P3h2 APN 16 25,811,548 (GRCm39) missense probably damaging 1.00
IGL01012:P3h2 APN 16 25,805,998 (GRCm39) missense probably damaging 0.98
IGL02393:P3h2 APN 16 25,811,575 (GRCm39) missense probably damaging 1.00
IGL02436:P3h2 APN 16 25,815,950 (GRCm39) missense probably benign 0.01
PIT4445001:P3h2 UTSW 16 25,803,749 (GRCm39) missense probably benign 0.01
R0319:P3h2 UTSW 16 25,789,681 (GRCm39) missense possibly damaging 0.93
R0403:P3h2 UTSW 16 25,788,700 (GRCm39) missense possibly damaging 0.63
R0962:P3h2 UTSW 16 25,815,998 (GRCm39) missense probably benign
R1290:P3h2 UTSW 16 25,805,953 (GRCm39) missense probably damaging 0.99
R1300:P3h2 UTSW 16 25,815,986 (GRCm39) nonsense probably null
R1467:P3h2 UTSW 16 25,784,618 (GRCm39) splice site probably benign
R1643:P3h2 UTSW 16 25,791,041 (GRCm39) missense probably benign 0.00
R1645:P3h2 UTSW 16 25,815,982 (GRCm39) missense probably damaging 1.00
R1761:P3h2 UTSW 16 25,803,800 (GRCm39) missense probably damaging 0.96
R4227:P3h2 UTSW 16 25,924,203 (GRCm39) missense probably benign
R4273:P3h2 UTSW 16 25,923,971 (GRCm39) missense probably benign 0.00
R4409:P3h2 UTSW 16 25,924,040 (GRCm39) missense possibly damaging 0.88
R4410:P3h2 UTSW 16 25,924,040 (GRCm39) missense possibly damaging 0.88
R4653:P3h2 UTSW 16 25,924,027 (GRCm39) missense probably damaging 0.98
R4968:P3h2 UTSW 16 25,811,412 (GRCm39) critical splice donor site probably null
R5190:P3h2 UTSW 16 25,803,699 (GRCm39) missense possibly damaging 0.86
R6113:P3h2 UTSW 16 25,799,903 (GRCm39) missense probably benign 0.01
R6225:P3h2 UTSW 16 25,784,493 (GRCm39) missense probably damaging 0.97
R6881:P3h2 UTSW 16 25,811,495 (GRCm39) missense probably damaging 1.00
R7089:P3h2 UTSW 16 25,784,559 (GRCm39) missense probably damaging 1.00
R7445:P3h2 UTSW 16 25,803,815 (GRCm39) missense probably damaging 0.96
R7753:P3h2 UTSW 16 25,789,687 (GRCm39) missense probably damaging 1.00
R8166:P3h2 UTSW 16 25,811,572 (GRCm39) missense possibly damaging 0.89
R8363:P3h2 UTSW 16 25,811,468 (GRCm39) missense probably damaging 0.98
R8442:P3h2 UTSW 16 25,805,955 (GRCm39) missense probably benign 0.05
R8812:P3h2 UTSW 16 25,801,467 (GRCm39) missense possibly damaging 0.67
R8965:P3h2 UTSW 16 25,791,134 (GRCm39) missense probably benign 0.41
R9187:P3h2 UTSW 16 25,924,186 (GRCm39) missense probably benign 0.27
R9193:P3h2 UTSW 16 25,923,991 (GRCm39) missense probably benign 0.07
R9533:P3h2 UTSW 16 25,789,725 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTTGCACGCAAAGCAGAG -3'
(R):5'- ACTACAGCGGCGACTATGAG -3'

Sequencing Primer
(F):5'- AGCCACTGCGAAAGGCTG -3'
(R):5'- ACTATGAGCGAGCGGTGC -3'
Posted On 2018-10-18