Mutagenetix > Incidental Mutations

Incidental Mutation 'R6838:Urb1'

537985

Institutional Source

Beutler Lab

Gene Symbol

Urb1

Ensembl Gene

ENSMUSG00000039929

Gene Name

URB1 ribosome biogenesis 1 homolog (S. cerevisiae)

Synonyms

4921511H13Rik, 5730405K23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6838 (G1)

Quality Score

115.008

Status

Validated

Chromosome

Chromosomal Location

90751527-90810413 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90782106 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 689 (D689V)

Ref Sequence

ENSEMBL: ENSMUSP00000114717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140920]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140920
AA Change: D689V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: D689V

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:Npa1	78	396	1.5e-86	PFAM
low complexity region	751	761	N/A	INTRINSIC
low complexity region	955	966	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
low complexity region	1360	1375	N/A	INTRINSIC
Pfam:NopRA1	1670	1859	3.6e-60	PFAM
low complexity region	2029	2040	N/A	INTRINSIC
low complexity region	2092	2111	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.7%

Validation Efficiency

97% (64/66)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Aqp9	T	A	9: 71,112,216	M321L	probably benign	Het
Avil	G	A	10: 127,013,562	D576N	probably benign	Het
Bbs1	C	T	19: 4,903,852	M94I	possibly damaging	Het
BC052040	T	C	2: 115,776,990	F275L	possibly damaging	Het
Bms1	A	G	6: 118,416,494	V139A	probably benign	Het
Bscl2	A	T	19: 8,841,381	M57L	probably damaging	Het
C2cd5	A	G	6: 143,029,638	I794T	possibly damaging	Het
C530008M17Rik	A	T	5: 76,858,209	T806S	unknown	Het
Cacna1s	C	T	1: 136,084,437	T539I	possibly damaging	Het
Cand1	T	C	10: 119,210,030	K990R	probably benign	Het
Capn7	A	G	14: 31,354,173	I311V	possibly damaging	Het
Cd180	A	G	13: 102,702,731	N41D	probably benign	Het
Celsr1	G	A	15: 85,939,194	T1671I	probably benign	Het
Cep135	A	T	5: 76,632,215	Q798L	probably damaging	Het
Cfap65	T	C	1: 74,932,021	D46G	probably benign	Het
Ddx46	G	T	13: 55,639,935		probably null	Het
Dnah7b	T	C	1: 46,191,788	L1402P	probably damaging	Het
Dnah8	A	G	17: 30,710,551	E1402G	probably damaging	Het
Dock9	A	G	14: 121,546,596	Y1989H	possibly damaging	Het
Ereg	A	G	5: 91,088,464	D50G	probably benign	Het
Evi5	G	T	5: 107,842,161	T64K	possibly damaging	Het
Frem3	A	C	8: 80,612,031	T318P	probably damaging	Het
Gm8693	T	A	7: 22,691,717	M201L	probably benign	Het
Gpx1	A	G	9: 108,339,940	D81G	possibly damaging	Het
Gramd1a	T	C	7: 31,134,504	I499V	probably benign	Het
Herc2	T	A	7: 56,108,778	D804E	probably damaging	Het
Hist1h4k	A	T	13: 21,750,205	F101I	probably damaging	Het
Hk1	T	C	10: 62,271,658	E846G	probably damaging	Het
Iars2	G	A	1: 185,329,145	A48V	probably damaging	Het
Invs	C	T	4: 48,283,278	T10M	possibly damaging	Het
Ism2	A	T	12: 87,280,201	D321E	probably benign	Het
Itpr1	T	C	6: 108,471,191	S231P	possibly damaging	Het
Kif17	A	T	4: 138,278,399		probably null	Het
Lvrn	A	G	18: 46,890,880	I765V	possibly damaging	Het
Map4k4	T	A	1: 39,976,722	C108S	probably damaging	Het
Mapk13	G	T	17: 28,777,561		probably null	Het
Mapkapk2	T	A	1: 131,058,003	K95*	probably null	Het
Mau2	A	T	8: 70,039,297		probably null	Het
Mex3a	A	G	3: 88,536,777	T387A	probably benign	Het
Myo5a	T	C	9: 75,153,883		probably null	Het
Ncbp3	A	T	11: 73,073,474	M417L	possibly damaging	Het
Nod2	A	C	8: 88,670,458	E810A	possibly damaging	Het
Nol3	A	T	8: 105,279,575	E152V	probably damaging	Het
Obox6	T	C	7: 15,833,739	E261G	possibly damaging	Het
Olfr875	A	C	9: 37,773,052	Y131S	possibly damaging	Het
Olfr91	A	T	17: 37,093,166	L236*	probably null	Het
P3h2	T	C	16: 26,105,284	S134G	possibly damaging	Het
Plxna2	A	T	1: 194,804,914	R1592S	possibly damaging	Het
Ppp1r12a	C	T	10: 108,261,276	S250L	possibly damaging	Het
Rab38	A	G	7: 88,450,709	D144G	possibly damaging	Het
Sept1	T	C	7: 127,216,722	M176V	probably benign	Het
Spata22	C	T	11: 73,345,933	T355M	probably benign	Het
Tango6	A	G	8: 106,742,074	N734S	probably benign	Het
Tbc1d17	C	A	7: 44,844,314	R295L	probably damaging	Het
Thsd7a	G	T	6: 12,504,075	P360Q	probably damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tnnt1	T	C	7: 4,507,407	N239S	possibly damaging	Het
Tpst1	A	T	5: 130,102,438	M250L	probably benign	Het
Usp28	T	A	9: 49,000,430		probably null	Het
Vldlr	G	A	19: 27,247,970	D816N	probably damaging	Het
Wdr1	A	G	5: 38,530,031	V219A	probably damaging	Het
Xndc1	T	C	7: 102,073,269	V47A	possibly damaging	Het
Zfp366	C	T	13: 99,228,507	P59S	possibly damaging	Het
Zfp366	A	G	13: 99,246,177	E616G	possibly damaging	Het
Zfp937	T	A	2: 150,239,346	I432K	probably benign	Het

Other mutations in Urb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Urb1	APN	16	90753321	critical splice donor site	probably null
IGL00915:Urb1	APN	16	90779098	missense	possibly damaging	0.76
IGL01108:Urb1	APN	16	90792814	missense	probably damaging	1.00
IGL01122:Urb1	APN	16	90804458	missense	possibly damaging	0.81
IGL01387:Urb1	APN	16	90757761	missense	possibly damaging	0.64
IGL01484:Urb1	APN	16	90777560	missense	probably benign	0.11
IGL01606:Urb1	APN	16	90760459	missense	probably damaging	1.00
IGL01989:Urb1	APN	16	90769586	splice site	probably benign
IGL02516:Urb1	APN	16	90772695	missense	possibly damaging	0.49
IGL03018:Urb1	APN	16	90788156	missense	probably benign	0.02
IGL03165:Urb1	APN	16	90780304	missense	probably damaging	1.00
IGL03216:Urb1	APN	16	90788114	missense	probably benign	0.00
H8562:Urb1	UTSW	16	90769469	missense	probably benign	0.08
H8786:Urb1	UTSW	16	90769469	missense	probably benign	0.08
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0359:Urb1	UTSW	16	90791160	missense	probably damaging	1.00
R0386:Urb1	UTSW	16	90796399	missense	probably damaging	1.00
R0508:Urb1	UTSW	16	90783262	splice site	probably benign
R0517:Urb1	UTSW	16	90777422	nonsense	probably null
R0704:Urb1	UTSW	16	90776207	missense	probably benign	0.31
R0755:Urb1	UTSW	16	90774094	missense	probably damaging	1.00
R0755:Urb1	UTSW	16	90779138	missense	probably benign
R0783:Urb1	UTSW	16	90810297	missense	possibly damaging	0.55
R0833:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0836:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0970:Urb1	UTSW	16	90769447	missense	possibly damaging	0.83
R1144:Urb1	UTSW	16	90776318	splice site	probably null
R1344:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1418:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1453:Urb1	UTSW	16	90796492	missense	probably damaging	1.00
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1520:Urb1	UTSW	16	90774745	missense	probably benign	0.00
R1521:Urb1	UTSW	16	90753863	missense	probably damaging	1.00
R1598:Urb1	UTSW	16	90777440	missense	possibly damaging	0.93
R1617:Urb1	UTSW	16	90760452	missense	possibly damaging	0.82
R1625:Urb1	UTSW	16	90774048	critical splice donor site	probably null
R1640:Urb1	UTSW	16	90772626	missense	probably benign	0.00
R1664:Urb1	UTSW	16	90788082	critical splice donor site	probably null
R1672:Urb1	UTSW	16	90787397	missense	probably damaging	1.00
R1694:Urb1	UTSW	16	90767040	missense	probably benign
R1856:Urb1	UTSW	16	90761695	missense	probably benign	0.00
R2001:Urb1	UTSW	16	90762344	missense	probably benign	0.30
R2196:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R2850:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R3009:Urb1	UTSW	16	90774798	missense	probably benign	0.09
R3104:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3105:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3106:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3160:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3162:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3900:Urb1	UTSW	16	90783376	missense	possibly damaging	0.86
R4014:Urb1	UTSW	16	90769465	missense	probably damaging	1.00
R4036:Urb1	UTSW	16	90788086	missense	probably benign
R4332:Urb1	UTSW	16	90774537	missense	probably damaging	1.00
R4448:Urb1	UTSW	16	90769394	missense	possibly damaging	0.71
R4581:Urb1	UTSW	16	90788146	missense	probably benign	0.04
R4593:Urb1	UTSW	16	90787444	missense	probably damaging	1.00
R4610:Urb1	UTSW	16	90776271	missense	probably benign	0.43
R4659:Urb1	UTSW	16	90776129	missense	probably damaging	0.96
R4672:Urb1	UTSW	16	90772634	missense	probably benign
R4681:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R4771:Urb1	UTSW	16	90753518	missense	probably benign	0.00
R4790:Urb1	UTSW	16	90769555	nonsense	probably null
R4798:Urb1	UTSW	16	90757827	missense	probably benign	0.12
R4809:Urb1	UTSW	16	90759842	missense	possibly damaging	0.82
R4850:Urb1	UTSW	16	90795414	nonsense	probably null
R4916:Urb1	UTSW	16	90783328	missense	probably damaging	1.00
R4969:Urb1	UTSW	16	90805411	missense	probably damaging	1.00
R5032:Urb1	UTSW	16	90756171	missense	probably benign	0.00
R5111:Urb1	UTSW	16	90752017	missense	probably benign	0.00
R5122:Urb1	UTSW	16	90752095	nonsense	probably null
R5184:Urb1	UTSW	16	90783274	critical splice donor site	probably null
R5199:Urb1	UTSW	16	90792748	missense	possibly damaging	0.95
R5436:Urb1	UTSW	16	90792762	missense	probably damaging	1.00
R5767:Urb1	UTSW	16	90776163	missense	probably benign	0.00
R5812:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R5872:Urb1	UTSW	16	90772764	nonsense	probably null
R6052:Urb1	UTSW	16	90762383	missense	probably damaging	1.00
R6063:Urb1	UTSW	16	90789097	missense	probably benign	0.02
R6065:Urb1	UTSW	16	90803332	missense	probably benign	0.03
R6181:Urb1	UTSW	16	90779094	missense	probably benign	0.00
R6268:Urb1	UTSW	16	90753919	missense	probably benign	0.03
R6429:Urb1	UTSW	16	90762430	splice site	probably null
R6572:Urb1	UTSW	16	90787414	missense	probably benign	0.37
R6606:Urb1	UTSW	16	90810268	missense	probably benign	0.00
R6730:Urb1	UTSW	16	90779083	missense	possibly damaging	0.89
R7237:Urb1	UTSW	16	90791166	missense	probably damaging	1.00
R7238:Urb1	UTSW	16	90752115	missense	possibly damaging	0.88
R7339:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7341:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7361:Urb1	UTSW	16	90774768	missense	probably damaging	0.99
R7365:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7366:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7440:Urb1	UTSW	16	90787408	missense	probably damaging	1.00
R7530:Urb1	UTSW	16	90761634	missense	probably damaging	1.00
R7553:Urb1	UTSW	16	90792864	missense	probably damaging	1.00
R7557:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7603:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7607:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7609:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7610:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7612:Urb1	UTSW	16	90797910	missense	probably damaging	1.00
R7613:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7684:Urb1	UTSW	16	90786118	nonsense	probably null
R8029:Urb1	UTSW	16	90779152	missense	possibly damaging	0.67
Z1177:Urb1	UTSW	16	90753883	missense	probably benign	0.00
Z1177:Urb1	UTSW	16	90774862	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GCAGTAAGAATTGCTCTTTCAGAGG -3'
(R):5'- CCTTCTCGGAGCTAAGGAAAGG -3'

Sequencing Primer
(F):5'- CTCTTTCAGAGGCTAACATGGAG -3'
(R):5'- AAAGGAGCCGTGGTGTCC -3'

Posted On

2018-10-18