Mutagenetix > Incidental Mutations

Incidental Mutation 'R6841:Ubr3'

538002

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6841 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70020625 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1796 (C1796S)

Ref Sequence

ENSEMBL: ENSMUSP00000107870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055758
AA Change: C1793S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: C1793S

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000112251
AA Change: C1796S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: C1796S

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.4%

Validation Efficiency

99% (71/72)

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	T	C	14: 49,243,813		probably null	Het
4932438A13Rik	A	G	3: 37,021,481	Y3610C	probably damaging	Het
A730071L15Rik	G	A	11: 6,200,439	W137*	probably null	Het
Acads	G	A	5: 115,112,358	T169I	probably benign	Het
Adgrg7	T	A	16: 56,750,424	N414Y	probably damaging	Het
Ankrd35	T	A	3: 96,670,426	S6T	probably damaging	Het
Armc3	A	G	2: 19,201,819		probably null	Het
Atp9a	C	A	2: 168,654,220	V555F	possibly damaging	Het
Cars2	C	T	8: 11,516,198	V443I	probably benign	Het
Cblc	A	G	7: 19,792,896	L137P	probably damaging	Het
Cdk5r1	T	A	11: 80,478,195	C229*	probably null	Het
Cep85	C	G	4: 134,155,856	A241P	probably benign	Het
Cfap54	T	C	10: 92,875,015	Y2728C	unknown	Het
Ckap5	T	A	2: 91,570,252	W650R	probably damaging	Het
Cnot11	C	T	1: 39,540,067	Q12*	probably null	Het
Commd6	A	T	14: 101,637,098	D19E	probably damaging	Het
Crygc	C	T	1: 65,073,202	G71D	possibly damaging	Het
Cstf3	A	G	2: 104,655,731	K439E	probably benign	Het
Cyp11b2	G	T	15: 74,855,491	H114N	probably benign	Het
Cyp2d40	T	C	15: 82,761,486	D106G	probably benign	Het
Dhx8	T	A	11: 101,764,792	V1117E	probably damaging	Het
Duoxa1	G	T	2: 122,303,981	L219I	probably damaging	Het
Dynap	A	T	18: 70,241,182	I91N	probably damaging	Het
Elfn1	G	T	5: 139,973,145	G635W	probably damaging	Het
Fan1	A	T	7: 64,364,629	I618N	probably damaging	Het
Fras1	A	G	5: 96,728,551	D2381G	probably damaging	Het
Fxyd6	T	A	9: 45,391,553		probably null	Het
Gpr137b	A	T	13: 13,363,509	W286R	probably damaging	Het
Gpsm3	A	T	17: 34,590,562		probably null	Het
Has1	C	T	17: 17,843,860	V506I	probably benign	Het
Hoxd10	T	A	2: 74,692,272	V98D	probably benign	Het
Htr2b	T	A	1: 86,099,893	D297V	probably benign	Het
Hydin	G	C	8: 110,538,375	R2730P	probably benign	Het
I830077J02Rik	T	C	3: 105,926,514	N109D	possibly damaging	Het
Igf2r	A	T	17: 12,703,376	F1284I	probably damaging	Het
Ildr2	C	G	1: 166,270,575	D167E	probably damaging	Het
Ipo9	T	C	1: 135,386,308	D949G	probably benign	Het
Itga10	T	C	3: 96,656,714	F895L	probably damaging	Het
Itpr1	A	G	6: 108,388,192	N27S	probably damaging	Het
Klra4	C	A	6: 130,065,199	R35L	probably benign	Het
Map3k2	T	A	18: 32,226,629	C512S	probably benign	Het
Mertk	A	G	2: 128,759,230		probably null	Het
Mgat2	T	A	12: 69,185,633	I327N	probably damaging	Het
Mogat1	T	C	1: 78,522,859	I59T	probably damaging	Het
Mrpl2	A	T	17: 46,647,456	M55L	probably benign	Het
Nxpe3	T	C	16: 55,844,322	M512V	possibly damaging	Het
Pcdh15	T	C	10: 74,450,220	L769P	probably damaging	Het
Pcmtd2	T	G	2: 181,844,438	V117G	probably damaging	Het
Pdia2	A	T	17: 26,196,604		probably null	Het
Repin1	A	T	6: 48,597,925	Q593L	possibly damaging	Het
Rnf213	C	T	11: 119,449,866	T3517I	probably benign	Het
Rxfp2	A	T	5: 150,018,745		probably benign	Het
Skint8	T	C	4: 111,928,771	L138P	probably damaging	Het
Slc35a3	T	A	3: 116,712,768	Q5L	probably null	Het
Stab2	T	A	10: 86,942,190	N758I	probably damaging	Het
Sulf1	T	A	1: 12,838,434	I557N	probably damaging	Het
Tbc1d8	T	C	1: 39,389,374	I497V	possibly damaging	Het
Ticam2	A	C	18: 46,560,931	S30A	probably benign	Het
Timp3	T	C	10: 86,345,774	S170P	possibly damaging	Het
Top1mt	C	T	15: 75,676,124	E38K	probably benign	Het
Tpp1	G	A	7: 105,748,964	L331F	probably damaging	Het
Trpm7	A	T	2: 126,813,021	D1332E	probably benign	Het
Ttc23	A	G	7: 67,669,728	E112G	possibly damaging	Het
Ttn	T	C	2: 76,884,952		probably benign	Het
Ttn	T	A	2: 76,896,590		probably benign	Het
Ugt2b34	C	T	5: 86,892,816	V416I	probably benign	Het
Uqcrb	A	G	13: 66,900,763		probably benign	Het
Vps26b	A	G	9: 27,010,464	L255P	probably benign	Het
Wdr59	A	G	8: 111,496,880	V154A	probably damaging	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1191:Ubr3	UTSW	2	70021181	nonsense	probably null
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2042:Ubr3	UTSW	2	69977774	nonsense	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5437:Ubr3	UTSW	2	69944390	missense	probably damaging	1.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6136:Ubr3	UTSW	2	69993763	missense	probably benign	0.26
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	intron	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6477:Ubr3	UTSW	2	69979429	nonsense	probably null
R6702:Ubr3	UTSW	2	69956049	missense	probably benign	0.23
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R6889:Ubr3	UTSW	2	69944300	missense	possibly damaging	0.70
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7209:Ubr3	UTSW	2	70016134	missense	probably benign	0.01
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCCTTGCTTATCCAAGAATCAAG -3'
(R):5'- TGCCCTGCATGTTAAAGGC -3'

Sequencing Primer
(F):5'- GATGGAAGTTACCACACCTGTTACAG -3'
(R):5'- CTGGGATTGTACTTAAGAAAGGC -3'

Posted On

2018-10-18