Incidental Mutation 'R6841:Ubr3'
ID538002
Institutional Source Beutler Lab
Gene Symbol Ubr3
Ensembl Gene ENSMUSG00000044308
Gene Nameubiquitin protein ligase E3 component n-recognin 3
SynonymsZfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6841 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location69897246-70024013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70020625 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1796 (C1796S)
Ref Sequence ENSEMBL: ENSMUSP00000107870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]
Predicted Effect probably damaging
Transcript: ENSMUST00000055758
AA Change: C1793S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: C1793S

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 118 188 1.6e-19 PFAM
low complexity region 339 354 N/A INTRINSIC
low complexity region 570 580 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1082 1101 N/A INTRINSIC
coiled coil region 1167 1199 N/A INTRINSIC
Blast:RING 1289 1363 8e-39 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112251
AA Change: C1796S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: C1796S

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 119 187 1.7e-21 PFAM
low complexity region 338 353 N/A INTRINSIC
low complexity region 569 579 N/A INTRINSIC
low complexity region 1015 1026 N/A INTRINSIC
low complexity region 1081 1100 N/A INTRINSIC
coiled coil region 1166 1198 N/A INTRINSIC
Blast:RING 1288 1362 8e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T C 14: 49,243,813 probably null Het
4932438A13Rik A G 3: 37,021,481 Y3610C probably damaging Het
A730071L15Rik G A 11: 6,200,439 W137* probably null Het
Acads G A 5: 115,112,358 T169I probably benign Het
Adgrg7 T A 16: 56,750,424 N414Y probably damaging Het
Ankrd35 T A 3: 96,670,426 S6T probably damaging Het
Armc3 A G 2: 19,201,819 probably null Het
Atp9a C A 2: 168,654,220 V555F possibly damaging Het
Cars2 C T 8: 11,516,198 V443I probably benign Het
Cblc A G 7: 19,792,896 L137P probably damaging Het
Cdk5r1 T A 11: 80,478,195 C229* probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Cfap54 T C 10: 92,875,015 Y2728C unknown Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
Cnot11 C T 1: 39,540,067 Q12* probably null Het
Commd6 A T 14: 101,637,098 D19E probably damaging Het
Crygc C T 1: 65,073,202 G71D possibly damaging Het
Cstf3 A G 2: 104,655,731 K439E probably benign Het
Cyp11b2 G T 15: 74,855,491 H114N probably benign Het
Cyp2d40 T C 15: 82,761,486 D106G probably benign Het
Dhx8 T A 11: 101,764,792 V1117E probably damaging Het
Duoxa1 G T 2: 122,303,981 L219I probably damaging Het
Dynap A T 18: 70,241,182 I91N probably damaging Het
Elfn1 G T 5: 139,973,145 G635W probably damaging Het
Fan1 A T 7: 64,364,629 I618N probably damaging Het
Fras1 A G 5: 96,728,551 D2381G probably damaging Het
Fxyd6 T A 9: 45,391,553 probably null Het
Gpr137b A T 13: 13,363,509 W286R probably damaging Het
Gpsm3 A T 17: 34,590,562 probably null Het
Has1 C T 17: 17,843,860 V506I probably benign Het
Hoxd10 T A 2: 74,692,272 V98D probably benign Het
Htr2b T A 1: 86,099,893 D297V probably benign Het
Hydin G C 8: 110,538,375 R2730P probably benign Het
I830077J02Rik T C 3: 105,926,514 N109D possibly damaging Het
Igf2r A T 17: 12,703,376 F1284I probably damaging Het
Ildr2 C G 1: 166,270,575 D167E probably damaging Het
Ipo9 T C 1: 135,386,308 D949G probably benign Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Itpr1 A G 6: 108,388,192 N27S probably damaging Het
Klra4 C A 6: 130,065,199 R35L probably benign Het
Map3k2 T A 18: 32,226,629 C512S probably benign Het
Mertk A G 2: 128,759,230 probably null Het
Mgat2 T A 12: 69,185,633 I327N probably damaging Het
Mogat1 T C 1: 78,522,859 I59T probably damaging Het
Mrpl2 A T 17: 46,647,456 M55L probably benign Het
Nxpe3 T C 16: 55,844,322 M512V possibly damaging Het
Pcdh15 T C 10: 74,450,220 L769P probably damaging Het
Pcmtd2 T G 2: 181,844,438 V117G probably damaging Het
Pdia2 A T 17: 26,196,604 probably null Het
Repin1 A T 6: 48,597,925 Q593L possibly damaging Het
Rnf213 C T 11: 119,449,866 T3517I probably benign Het
Rxfp2 A T 5: 150,018,745 probably benign Het
Skint8 T C 4: 111,928,771 L138P probably damaging Het
Slc35a3 T A 3: 116,712,768 Q5L probably null Het
Stab2 T A 10: 86,942,190 N758I probably damaging Het
Sulf1 T A 1: 12,838,434 I557N probably damaging Het
Tbc1d8 T C 1: 39,389,374 I497V possibly damaging Het
Ticam2 A C 18: 46,560,931 S30A probably benign Het
Timp3 T C 10: 86,345,774 S170P possibly damaging Het
Top1mt C T 15: 75,676,124 E38K probably benign Het
Tpp1 G A 7: 105,748,964 L331F probably damaging Het
Trpm7 A T 2: 126,813,021 D1332E probably benign Het
Ttc23 A G 7: 67,669,728 E112G possibly damaging Het
Ttn T C 2: 76,884,952 probably benign Het
Ttn T A 2: 76,896,590 probably benign Het
Ugt2b34 C T 5: 86,892,816 V416I probably benign Het
Uqcrb A G 13: 66,900,763 probably benign Het
Vps26b A G 9: 27,010,464 L255P probably benign Het
Wdr59 A G 8: 111,496,880 V154A probably damaging Het
Other mutations in Ubr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ubr3 APN 2 69988810 missense probably benign 0.40
IGL00985:Ubr3 APN 2 70003431 missense probably damaging 1.00
IGL01061:Ubr3 APN 2 69983225 missense probably benign 0.05
IGL01325:Ubr3 APN 2 69917097 missense possibly damaging 0.71
IGL01398:Ubr3 APN 2 69959653 missense probably damaging 1.00
IGL01484:Ubr3 APN 2 70021544 nonsense probably null
IGL01599:Ubr3 APN 2 69938178 missense probably damaging 1.00
IGL01616:Ubr3 APN 2 70020484 missense probably benign 0.14
IGL01634:Ubr3 APN 2 69973572 missense probably benign
IGL01684:Ubr3 APN 2 70016158 nonsense probably null
IGL01810:Ubr3 APN 2 70003465 splice site probably null
IGL01813:Ubr3 APN 2 69951570 missense probably benign 0.34
IGL01994:Ubr3 APN 2 70021176 missense probably damaging 1.00
IGL02188:Ubr3 APN 2 69959611 nonsense probably null
IGL02318:Ubr3 APN 2 69979397 missense probably damaging 1.00
IGL02379:Ubr3 APN 2 69948488 missense possibly damaging 0.91
IGL02635:Ubr3 APN 2 70020483 missense probably damaging 0.96
IGL02858:Ubr3 APN 2 69952859 missense probably damaging 1.00
IGL03140:Ubr3 APN 2 69970189 missense probably damaging 1.00
IGL03343:Ubr3 APN 2 69973146 splice site probably benign
Hyrax UTSW 2 69952868 missense probably benign 0.32
manatee UTSW 2 69979386 nonsense probably null
sea_cow UTSW 2 69959669 splice site probably null
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0122:Ubr3 UTSW 2 69979412 missense probably damaging 1.00
R0243:Ubr3 UTSW 2 69951405 missense probably damaging 1.00
R0710:Ubr3 UTSW 2 69952837 missense probably damaging 1.00
R0787:Ubr3 UTSW 2 69951421 splice site probably benign
R1137:Ubr3 UTSW 2 69938315 splice site probably benign
R1191:Ubr3 UTSW 2 70021181 nonsense probably null
R1416:Ubr3 UTSW 2 69945071 missense probably damaging 1.00
R1623:Ubr3 UTSW 2 69977723 nonsense probably null
R1735:Ubr3 UTSW 2 70009129 missense probably damaging 1.00
R1789:Ubr3 UTSW 2 70016367 missense possibly damaging 0.87
R1793:Ubr3 UTSW 2 70000551 splice site probably benign
R1932:Ubr3 UTSW 2 69953476 splice site probably null
R2042:Ubr3 UTSW 2 69977774 nonsense probably null
R2085:Ubr3 UTSW 2 69953764 missense probably damaging 1.00
R2090:Ubr3 UTSW 2 69936017 missense probably damaging 1.00
R2112:Ubr3 UTSW 2 69977792 missense possibly damaging 0.73
R2173:Ubr3 UTSW 2 69897399 missense probably benign
R2215:Ubr3 UTSW 2 69979317 critical splice acceptor site probably null
R2273:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2274:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2275:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2292:Ubr3 UTSW 2 69897260 unclassified probably benign
R2447:Ubr3 UTSW 2 70003380 missense probably damaging 1.00
R2504:Ubr3 UTSW 2 69938198 missense probably damaging 0.99
R2517:Ubr3 UTSW 2 69936018 missense probably damaging 1.00
R2901:Ubr3 UTSW 2 70016192 missense possibly damaging 0.89
R3109:Ubr3 UTSW 2 69988840 missense probably damaging 1.00
R3737:Ubr3 UTSW 2 69971234 critical splice donor site probably null
R3793:Ubr3 UTSW 2 69917181 missense possibly damaging 0.95
R3821:Ubr3 UTSW 2 69993813 critical splice donor site probably null
R3918:Ubr3 UTSW 2 70016130 critical splice acceptor site probably null
R4157:Ubr3 UTSW 2 69959669 splice site probably null
R4235:Ubr3 UTSW 2 70016385 nonsense probably null
R4276:Ubr3 UTSW 2 69938387 nonsense probably null
R4544:Ubr3 UTSW 2 69956093 missense probably benign 0.18
R4678:Ubr3 UTSW 2 69935919 missense probably damaging 1.00
R4707:Ubr3 UTSW 2 69938370 intron probably benign
R4785:Ubr3 UTSW 2 69959603 missense probably damaging 1.00
R4872:Ubr3 UTSW 2 69970183 missense probably damaging 1.00
R4887:Ubr3 UTSW 2 70013131 missense probably damaging 0.99
R4920:Ubr3 UTSW 2 69952868 missense probably benign 0.32
R4989:Ubr3 UTSW 2 70020446 splice site probably benign
R5104:Ubr3 UTSW 2 69938256 missense probably damaging 0.98
R5134:Ubr3 UTSW 2 70020446 splice site probably benign
R5137:Ubr3 UTSW 2 69973335 missense probably damaging 1.00
R5174:Ubr3 UTSW 2 70009162 missense probably damaging 1.00
R5195:Ubr3 UTSW 2 69956034 missense probably benign 0.00
R5437:Ubr3 UTSW 2 69944390 missense probably damaging 1.00
R5539:Ubr3 UTSW 2 70020533 missense probably damaging 1.00
R5781:Ubr3 UTSW 2 70016244 splice site probably null
R5809:Ubr3 UTSW 2 69965511 missense possibly damaging 0.90
R5913:Ubr3 UTSW 2 70021215 missense probably damaging 1.00
R5969:Ubr3 UTSW 2 69979386 nonsense probably null
R6136:Ubr3 UTSW 2 69993763 missense probably benign 0.26
R6140:Ubr3 UTSW 2 69973329 missense probably benign 0.09
R6185:Ubr3 UTSW 2 69938277 missense probably damaging 0.98
R6220:Ubr3 UTSW 2 70020475 missense probably damaging 1.00
R6258:Ubr3 UTSW 2 69982864 intron probably null
R6319:Ubr3 UTSW 2 69973414 missense probably benign 0.00
R6322:Ubr3 UTSW 2 69956085 nonsense probably null
R6470:Ubr3 UTSW 2 69965460 missense probably benign 0.02
R6477:Ubr3 UTSW 2 69979429 nonsense probably null
R6702:Ubr3 UTSW 2 69956049 missense probably benign 0.23
R6709:Ubr3 UTSW 2 70013092 missense probably damaging 1.00
R6803:Ubr3 UTSW 2 69936024 critical splice donor site probably null
R6806:Ubr3 UTSW 2 69955964 splice site probably benign
R6834:Ubr3 UTSW 2 70000481 missense possibly damaging 0.63
R6847:Ubr3 UTSW 2 69983128 missense probably damaging 1.00
R6889:Ubr3 UTSW 2 69944300 missense possibly damaging 0.70
R7065:Ubr3 UTSW 2 69953705 missense probably damaging 1.00
R7102:Ubr3 UTSW 2 69897822 missense probably damaging 1.00
R7156:Ubr3 UTSW 2 70021623 missense probably damaging 1.00
R7209:Ubr3 UTSW 2 70016134 missense probably benign 0.01
R7273:Ubr3 UTSW 2 69979333 missense probably damaging 0.97
R7314:Ubr3 UTSW 2 69991600 missense probably damaging 1.00
R7422:Ubr3 UTSW 2 69953542 critical splice donor site probably null
R7584:Ubr3 UTSW 2 69991503 missense probably damaging 1.00
R7588:Ubr3 UTSW 2 69971169 missense probably damaging 1.00
R7597:Ubr3 UTSW 2 69973468 missense possibly damaging 0.69
R7697:Ubr3 UTSW 2 69897686 missense probably damaging 1.00
R7737:Ubr3 UTSW 2 69991566 missense probably benign 0.07
R7743:Ubr3 UTSW 2 69944449 missense probably benign 0.28
Z1088:Ubr3 UTSW 2 69922367 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCTTGCTTATCCAAGAATCAAG -3'
(R):5'- TGCCCTGCATGTTAAAGGC -3'

Sequencing Primer
(F):5'- GATGGAAGTTACCACACCTGTTACAG -3'
(R):5'- CTGGGATTGTACTTAAGAAAGGC -3'
Posted On2018-10-18