Mutagenetix > Incidental Mutations

Incidental Mutation 'R6841:Mertk'

538010

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R6841 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to G at 128759230 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

Predicted Effect

probably null
Transcript: ENSMUST00000014505

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.4%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	T	C	14: 49,243,813		probably null	Het
4932438A13Rik	A	G	3: 37,021,481	Y3610C	probably damaging	Het
A730071L15Rik	G	A	11: 6,200,439	W137*	probably null	Het
Acads	G	A	5: 115,112,358	T169I	probably benign	Het
Adgrg7	T	A	16: 56,750,424	N414Y	probably damaging	Het
Ankrd35	T	A	3: 96,670,426	S6T	probably damaging	Het
Armc3	A	G	2: 19,201,819		probably null	Het
Atp9a	C	A	2: 168,654,220	V555F	possibly damaging	Het
Cars2	C	T	8: 11,516,198	V443I	probably benign	Het
Cblc	A	G	7: 19,792,896	L137P	probably damaging	Het
Cdk5r1	T	A	11: 80,478,195	C229*	probably null	Het
Cep85	C	G	4: 134,155,856	A241P	probably benign	Het
Cfap54	T	C	10: 92,875,015	Y2728C	unknown	Het
Ckap5	T	A	2: 91,570,252	W650R	probably damaging	Het
Cnot11	C	T	1: 39,540,067	Q12*	probably null	Het
Commd6	A	T	14: 101,637,098	D19E	probably damaging	Het
Crygc	C	T	1: 65,073,202	G71D	possibly damaging	Het
Cstf3	A	G	2: 104,655,731	K439E	probably benign	Het
Cyp11b2	G	T	15: 74,855,491	H114N	probably benign	Het
Cyp2d40	T	C	15: 82,761,486	D106G	probably benign	Het
Dhx8	T	A	11: 101,764,792	V1117E	probably damaging	Het
Duoxa1	G	T	2: 122,303,981	L219I	probably damaging	Het
Dynap	A	T	18: 70,241,182	I91N	probably damaging	Het
Elfn1	G	T	5: 139,973,145	G635W	probably damaging	Het
Fan1	A	T	7: 64,364,629	I618N	probably damaging	Het
Fras1	A	G	5: 96,728,551	D2381G	probably damaging	Het
Fxyd6	T	A	9: 45,391,553		probably null	Het
Gpr137b	A	T	13: 13,363,509	W286R	probably damaging	Het
Gpsm3	A	T	17: 34,590,562		probably null	Het
Has1	C	T	17: 17,843,860	V506I	probably benign	Het
Hoxd10	T	A	2: 74,692,272	V98D	probably benign	Het
Htr2b	T	A	1: 86,099,893	D297V	probably benign	Het
Hydin	G	C	8: 110,538,375	R2730P	probably benign	Het
I830077J02Rik	T	C	3: 105,926,514	N109D	possibly damaging	Het
Igf2r	A	T	17: 12,703,376	F1284I	probably damaging	Het
Ildr2	C	G	1: 166,270,575	D167E	probably damaging	Het
Ipo9	T	C	1: 135,386,308	D949G	probably benign	Het
Itga10	T	C	3: 96,656,714	F895L	probably damaging	Het
Itpr1	A	G	6: 108,388,192	N27S	probably damaging	Het
Klra4	C	A	6: 130,065,199	R35L	probably benign	Het
Map3k2	T	A	18: 32,226,629	C512S	probably benign	Het
Mgat2	T	A	12: 69,185,633	I327N	probably damaging	Het
Mogat1	T	C	1: 78,522,859	I59T	probably damaging	Het
Mrpl2	A	T	17: 46,647,456	M55L	probably benign	Het
Nxpe3	T	C	16: 55,844,322	M512V	possibly damaging	Het
Pcdh15	T	C	10: 74,450,220	L769P	probably damaging	Het
Pcmtd2	T	G	2: 181,844,438	V117G	probably damaging	Het
Pdia2	A	T	17: 26,196,604		probably null	Het
Repin1	A	T	6: 48,597,925	Q593L	possibly damaging	Het
Rnf213	C	T	11: 119,449,866	T3517I	probably benign	Het
Rxfp2	A	T	5: 150,018,745		probably benign	Het
Skint8	T	C	4: 111,928,771	L138P	probably damaging	Het
Slc35a3	T	A	3: 116,712,768	Q5L	probably null	Het
Stab2	T	A	10: 86,942,190	N758I	probably damaging	Het
Sulf1	T	A	1: 12,838,434	I557N	probably damaging	Het
Tbc1d8	T	C	1: 39,389,374	I497V	possibly damaging	Het
Ticam2	A	C	18: 46,560,931	S30A	probably benign	Het
Timp3	T	C	10: 86,345,774	S170P	possibly damaging	Het
Top1mt	C	T	15: 75,676,124	E38K	probably benign	Het
Tpp1	G	A	7: 105,748,964	L331F	probably damaging	Het
Trpm7	A	T	2: 126,813,021	D1332E	probably benign	Het
Ttc23	A	G	7: 67,669,728	E112G	possibly damaging	Het
Ttn	T	C	2: 76,884,952		probably benign	Het
Ttn	T	A	2: 76,896,590		probably benign	Het
Ubr3	T	A	2: 70,020,625	C1796S	probably damaging	Het
Ugt2b34	C	T	5: 86,892,816	V416I	probably benign	Het
Uqcrb	A	G	13: 66,900,763		probably benign	Het
Vps26b	A	G	9: 27,010,464	L255P	probably benign	Het
Wdr59	A	G	8: 111,496,880	V154A	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGTAATGGCTCAGTCATGG -3'
(R):5'- GCCGCTGTCTTTCCATGTAAAAG -3'

Sequencing Primer
(F):5'- GGCTCAGTCATGGTTTTTAATACC -3'
(R):5'- GCTGTCTTTCCATGTAAAAGAAAATG -3'

Posted On

2018-10-18