Incidental Mutation 'R6841:Elfn1'
ID538024
Institutional Source Beutler Lab
Gene Symbol Elfn1
Ensembl Gene ENSMUSG00000048988
Gene Nameleucine rich repeat and fibronectin type III, extracellular 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6841 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location139907943-139974722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 139973145 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 635 (G635W)
Ref Sequence ENSEMBL: ENSMUSP00000053869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050519]
Predicted Effect probably damaging
Transcript: ENSMUST00000050519
AA Change: G635W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053869
Gene: ENSMUSG00000048988
AA Change: G635W

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 83 106 3.24e0 SMART
LRR 109 130 9.22e0 SMART
LRR 131 154 4.2e0 SMART
LRR 155 178 6.78e1 SMART
LRRCT 190 240 4.49e-4 SMART
low complexity region 268 288 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
Blast:FN3 314 389 1e-27 BLAST
low complexity region 400 413 N/A INTRINSIC
transmembrane domain 418 440 N/A INTRINSIC
low complexity region 441 463 N/A INTRINSIC
low complexity region 632 652 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Homozygous mutants display impaired coordination, hyperactivity, lower anxiety-related response, and increased susceptibility to induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T C 14: 49,243,813 probably null Het
4932438A13Rik A G 3: 37,021,481 Y3610C probably damaging Het
A730071L15Rik G A 11: 6,200,439 W137* probably null Het
Acads G A 5: 115,112,358 T169I probably benign Het
Adgrg7 T A 16: 56,750,424 N414Y probably damaging Het
Ankrd35 T A 3: 96,670,426 S6T probably damaging Het
Armc3 A G 2: 19,201,819 probably null Het
Atp9a C A 2: 168,654,220 V555F possibly damaging Het
Cars2 C T 8: 11,516,198 V443I probably benign Het
Cblc A G 7: 19,792,896 L137P probably damaging Het
Cdk5r1 T A 11: 80,478,195 C229* probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Cfap54 T C 10: 92,875,015 Y2728C unknown Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
Cnot11 C T 1: 39,540,067 Q12* probably null Het
Commd6 A T 14: 101,637,098 D19E probably damaging Het
Crygc C T 1: 65,073,202 G71D possibly damaging Het
Cstf3 A G 2: 104,655,731 K439E probably benign Het
Cyp11b2 G T 15: 74,855,491 H114N probably benign Het
Cyp2d40 T C 15: 82,761,486 D106G probably benign Het
Dhx8 T A 11: 101,764,792 V1117E probably damaging Het
Duoxa1 G T 2: 122,303,981 L219I probably damaging Het
Dynap A T 18: 70,241,182 I91N probably damaging Het
Fan1 A T 7: 64,364,629 I618N probably damaging Het
Fras1 A G 5: 96,728,551 D2381G probably damaging Het
Fxyd6 T A 9: 45,391,553 probably null Het
Gpr137b A T 13: 13,363,509 W286R probably damaging Het
Gpsm3 A T 17: 34,590,562 probably null Het
Has1 C T 17: 17,843,860 V506I probably benign Het
Hoxd10 T A 2: 74,692,272 V98D probably benign Het
Htr2b T A 1: 86,099,893 D297V probably benign Het
Hydin G C 8: 110,538,375 R2730P probably benign Het
I830077J02Rik T C 3: 105,926,514 N109D possibly damaging Het
Igf2r A T 17: 12,703,376 F1284I probably damaging Het
Ildr2 C G 1: 166,270,575 D167E probably damaging Het
Ipo9 T C 1: 135,386,308 D949G probably benign Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Itpr1 A G 6: 108,388,192 N27S probably damaging Het
Klra4 C A 6: 130,065,199 R35L probably benign Het
Map3k2 T A 18: 32,226,629 C512S probably benign Het
Mertk A G 2: 128,759,230 probably null Het
Mgat2 T A 12: 69,185,633 I327N probably damaging Het
Mogat1 T C 1: 78,522,859 I59T probably damaging Het
Mrpl2 A T 17: 46,647,456 M55L probably benign Het
Nxpe3 T C 16: 55,844,322 M512V possibly damaging Het
Pcdh15 T C 10: 74,450,220 L769P probably damaging Het
Pcmtd2 T G 2: 181,844,438 V117G probably damaging Het
Pdia2 A T 17: 26,196,604 probably null Het
Repin1 A T 6: 48,597,925 Q593L possibly damaging Het
Rnf213 C T 11: 119,449,866 T3517I probably benign Het
Rxfp2 A T 5: 150,018,745 probably benign Het
Skint8 T C 4: 111,928,771 L138P probably damaging Het
Slc35a3 T A 3: 116,712,768 Q5L probably null Het
Stab2 T A 10: 86,942,190 N758I probably damaging Het
Sulf1 T A 1: 12,838,434 I557N probably damaging Het
Tbc1d8 T C 1: 39,389,374 I497V possibly damaging Het
Ticam2 A C 18: 46,560,931 S30A probably benign Het
Timp3 T C 10: 86,345,774 S170P possibly damaging Het
Top1mt C T 15: 75,676,124 E38K probably benign Het
Tpp1 G A 7: 105,748,964 L331F probably damaging Het
Trpm7 A T 2: 126,813,021 D1332E probably benign Het
Ttc23 A G 7: 67,669,728 E112G possibly damaging Het
Ttn T C 2: 76,884,952 probably benign Het
Ttn T A 2: 76,896,590 probably benign Het
Ubr3 T A 2: 70,020,625 C1796S probably damaging Het
Ugt2b34 C T 5: 86,892,816 V416I probably benign Het
Uqcrb A G 13: 66,900,763 probably benign Het
Vps26b A G 9: 27,010,464 L255P probably benign Het
Wdr59 A G 8: 111,496,880 V154A probably damaging Het
Other mutations in Elfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1969:Elfn1 UTSW 5 139972849 missense probably damaging 1.00
R2010:Elfn1 UTSW 5 139973316 missense probably damaging 1.00
R3702:Elfn1 UTSW 5 139972359 missense probably benign
R3898:Elfn1 UTSW 5 139971964 missense probably damaging 1.00
R3900:Elfn1 UTSW 5 139971964 missense probably damaging 1.00
R4284:Elfn1 UTSW 5 139972314 nonsense probably null
R4416:Elfn1 UTSW 5 139972194 missense possibly damaging 0.52
R4575:Elfn1 UTSW 5 139972053 missense probably benign
R4576:Elfn1 UTSW 5 139972053 missense probably benign
R4578:Elfn1 UTSW 5 139972053 missense probably benign
R4617:Elfn1 UTSW 5 139972009 missense probably damaging 0.99
R4729:Elfn1 UTSW 5 139973658 missense probably damaging 1.00
R4857:Elfn1 UTSW 5 139973085 missense probably damaging 1.00
R5431:Elfn1 UTSW 5 139971568 missense probably damaging 0.99
R5456:Elfn1 UTSW 5 139972816 missense probably damaging 1.00
R6463:Elfn1 UTSW 5 139972285 missense probably damaging 1.00
R6925:Elfn1 UTSW 5 139971685 missense probably benign 0.02
R7224:Elfn1 UTSW 5 139972473 missense probably benign 0.00
R7465:Elfn1 UTSW 5 139972087 missense probably benign 0.34
V7732:Elfn1 UTSW 5 139971439 missense probably damaging 1.00
Z1177:Elfn1 UTSW 5 139972308 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTAACAACTGCATCGACGCC -3'
(R):5'- GGCTGGATGAATAGCTCAGG -3'

Sequencing Primer
(F):5'- TGCATCGACGCCCTCAAGTC -3'
(R):5'- TCCAGGATGGATGCCTTGC -3'
Posted On2018-10-18