Incidental Mutation 'R6841:Cblc'
ID538029
Institutional Source Beutler Lab
Gene Symbol Cblc
Ensembl Gene ENSMUSG00000040525
Gene NameCasitas B-lineage lymphoma c
Synonyms2310076I21Rik, Cbl3, 2310079L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6841 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19778881-19796809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19792896 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 137 (L137P)
Ref Sequence ENSEMBL: ENSMUSP00000104088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043822] [ENSMUST00000108449]
Predicted Effect probably damaging
Transcript: ENSMUST00000043822
AA Change: L137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039955
Gene: ENSMUSG00000040525
AA Change: L137P

DomainStartEndE-ValueType
Pfam:Cbl_N 13 144 2.6e-44 PFAM
Pfam:Cbl_N2 148 231 1.8e-35 PFAM
SH2 234 347 4.35e0 SMART
RING 350 388 1.92e-6 SMART
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108449
AA Change: L137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104088
Gene: ENSMUSG00000040525
AA Change: L137P

DomainStartEndE-ValueType
Pfam:Cbl_N 11 145 7.1e-20 PFAM
Pfam:Cbl_N2 147 231 2.3e-48 PFAM
SH2 234 333 5.28e0 SMART
low complexity region 414 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no abnormalities of the epithelium or other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T C 14: 49,243,813 probably null Het
4932438A13Rik A G 3: 37,021,481 Y3610C probably damaging Het
A730071L15Rik G A 11: 6,200,439 W137* probably null Het
Acads G A 5: 115,112,358 T169I probably benign Het
Adgrg7 T A 16: 56,750,424 N414Y probably damaging Het
Ankrd35 T A 3: 96,670,426 S6T probably damaging Het
Armc3 A G 2: 19,201,819 probably null Het
Atp9a C A 2: 168,654,220 V555F possibly damaging Het
Cars2 C T 8: 11,516,198 V443I probably benign Het
Cdk5r1 T A 11: 80,478,195 C229* probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Cfap54 T C 10: 92,875,015 Y2728C unknown Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
Cnot11 C T 1: 39,540,067 Q12* probably null Het
Commd6 A T 14: 101,637,098 D19E probably damaging Het
Crygc C T 1: 65,073,202 G71D possibly damaging Het
Cstf3 A G 2: 104,655,731 K439E probably benign Het
Cyp11b2 G T 15: 74,855,491 H114N probably benign Het
Cyp2d40 T C 15: 82,761,486 D106G probably benign Het
Dhx8 T A 11: 101,764,792 V1117E probably damaging Het
Duoxa1 G T 2: 122,303,981 L219I probably damaging Het
Dynap A T 18: 70,241,182 I91N probably damaging Het
Elfn1 G T 5: 139,973,145 G635W probably damaging Het
Fan1 A T 7: 64,364,629 I618N probably damaging Het
Fras1 A G 5: 96,728,551 D2381G probably damaging Het
Fxyd6 T A 9: 45,391,553 probably null Het
Gpr137b A T 13: 13,363,509 W286R probably damaging Het
Gpsm3 A T 17: 34,590,562 probably null Het
Has1 C T 17: 17,843,860 V506I probably benign Het
Hoxd10 T A 2: 74,692,272 V98D probably benign Het
Htr2b T A 1: 86,099,893 D297V probably benign Het
Hydin G C 8: 110,538,375 R2730P probably benign Het
I830077J02Rik T C 3: 105,926,514 N109D possibly damaging Het
Igf2r A T 17: 12,703,376 F1284I probably damaging Het
Ildr2 C G 1: 166,270,575 D167E probably damaging Het
Ipo9 T C 1: 135,386,308 D949G probably benign Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Itpr1 A G 6: 108,388,192 N27S probably damaging Het
Klra4 C A 6: 130,065,199 R35L probably benign Het
Map3k2 T A 18: 32,226,629 C512S probably benign Het
Mertk A G 2: 128,759,230 probably null Het
Mgat2 T A 12: 69,185,633 I327N probably damaging Het
Mogat1 T C 1: 78,522,859 I59T probably damaging Het
Mrpl2 A T 17: 46,647,456 M55L probably benign Het
Nxpe3 T C 16: 55,844,322 M512V possibly damaging Het
Pcdh15 T C 10: 74,450,220 L769P probably damaging Het
Pcmtd2 T G 2: 181,844,438 V117G probably damaging Het
Pdia2 A T 17: 26,196,604 probably null Het
Repin1 A T 6: 48,597,925 Q593L possibly damaging Het
Rnf213 C T 11: 119,449,866 T3517I probably benign Het
Rxfp2 A T 5: 150,018,745 probably benign Het
Skint8 T C 4: 111,928,771 L138P probably damaging Het
Slc35a3 T A 3: 116,712,768 Q5L probably null Het
Stab2 T A 10: 86,942,190 N758I probably damaging Het
Sulf1 T A 1: 12,838,434 I557N probably damaging Het
Tbc1d8 T C 1: 39,389,374 I497V possibly damaging Het
Ticam2 A C 18: 46,560,931 S30A probably benign Het
Timp3 T C 10: 86,345,774 S170P possibly damaging Het
Top1mt C T 15: 75,676,124 E38K probably benign Het
Tpp1 G A 7: 105,748,964 L331F probably damaging Het
Trpm7 A T 2: 126,813,021 D1332E probably benign Het
Ttc23 A G 7: 67,669,728 E112G possibly damaging Het
Ttn T C 2: 76,884,952 probably benign Het
Ttn T A 2: 76,896,590 probably benign Het
Ubr3 T A 2: 70,020,625 C1796S probably damaging Het
Ugt2b34 C T 5: 86,892,816 V416I probably benign Het
Uqcrb A G 13: 66,900,763 probably benign Het
Vps26b A G 9: 27,010,464 L255P probably benign Het
Wdr59 A G 8: 111,496,880 V154A probably damaging Het
Other mutations in Cblc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Cblc APN 7 19785275 missense probably benign 0.00
R0583:Cblc UTSW 7 19792561 missense probably benign 0.41
R0847:Cblc UTSW 7 19790534 nonsense probably null
R1594:Cblc UTSW 7 19792546 missense probably damaging 1.00
R1626:Cblc UTSW 7 19796502 missense probably damaging 1.00
R1719:Cblc UTSW 7 19790474 missense probably benign 0.00
R1894:Cblc UTSW 7 19792577 missense probably damaging 0.99
R2011:Cblc UTSW 7 19784822 missense probably benign 0.01
R2395:Cblc UTSW 7 19785380 missense probably damaging 1.00
R2852:Cblc UTSW 7 19780964 splice site probably null
R3832:Cblc UTSW 7 19792172 missense probably damaging 0.98
R4696:Cblc UTSW 7 19796482 missense probably damaging 1.00
R5159:Cblc UTSW 7 19785308 missense probably benign 0.01
R5328:Cblc UTSW 7 19792580 missense possibly damaging 0.68
R5487:Cblc UTSW 7 19784808 missense probably benign 0.06
R5659:Cblc UTSW 7 19792932 missense probably damaging 1.00
R6209:Cblc UTSW 7 19785305 missense possibly damaging 0.47
R6519:Cblc UTSW 7 19792863 missense probably damaging 1.00
R7371:Cblc UTSW 7 19792903 missense probably benign 0.00
R7417:Cblc UTSW 7 19788974 missense probably benign 0.41
R7494:Cblc UTSW 7 19792812 missense possibly damaging 0.76
X0028:Cblc UTSW 7 19785273 missense probably benign
Z1177:Cblc UTSW 7 19785278 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GGTATGGTTACAGCTACGGATG -3'
(R):5'- TCAGAACTGAGACTGGCTCTTG -3'

Sequencing Primer
(F):5'- CTATGATAGGAAGAGGCTGTTCTCCC -3'
(R):5'- GACTCTCCCTACATCATGTG -3'
Posted On2018-10-18