Incidental Mutation 'R6841:Stab2'
ID538040
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Namestabilin 2
SynonymsSTAB-2, FEEL-2
MMRRC Submission
Accession Numbers

Genbank: NM_138673; MGI: 2178743

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6841 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location86841198-87008025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86942190 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 758 (N758I)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
Predicted Effect probably damaging
Transcript: ENSMUST00000035288
AA Change: N758I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: N758I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T C 14: 49,243,813 probably null Het
4932438A13Rik A G 3: 37,021,481 Y3610C probably damaging Het
A730071L15Rik G A 11: 6,200,439 W137* probably null Het
Acads G A 5: 115,112,358 T169I probably benign Het
Adgrg7 T A 16: 56,750,424 N414Y probably damaging Het
Ankrd35 T A 3: 96,670,426 S6T probably damaging Het
Armc3 A G 2: 19,201,819 probably null Het
Atp9a C A 2: 168,654,220 V555F possibly damaging Het
Cars2 C T 8: 11,516,198 V443I probably benign Het
Cblc A G 7: 19,792,896 L137P probably damaging Het
Cdk5r1 T A 11: 80,478,195 C229* probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Cfap54 T C 10: 92,875,015 Y2728C unknown Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
Cnot11 C T 1: 39,540,067 Q12* probably null Het
Commd6 A T 14: 101,637,098 D19E probably damaging Het
Crygc C T 1: 65,073,202 G71D possibly damaging Het
Cstf3 A G 2: 104,655,731 K439E probably benign Het
Cyp11b2 G T 15: 74,855,491 H114N probably benign Het
Cyp2d40 T C 15: 82,761,486 D106G probably benign Het
Dhx8 T A 11: 101,764,792 V1117E probably damaging Het
Duoxa1 G T 2: 122,303,981 L219I probably damaging Het
Dynap A T 18: 70,241,182 I91N probably damaging Het
Elfn1 G T 5: 139,973,145 G635W probably damaging Het
Fan1 A T 7: 64,364,629 I618N probably damaging Het
Fras1 A G 5: 96,728,551 D2381G probably damaging Het
Fxyd6 T A 9: 45,391,553 probably null Het
Gpr137b A T 13: 13,363,509 W286R probably damaging Het
Gpsm3 A T 17: 34,590,562 probably null Het
Has1 C T 17: 17,843,860 V506I probably benign Het
Hoxd10 T A 2: 74,692,272 V98D probably benign Het
Htr2b T A 1: 86,099,893 D297V probably benign Het
Hydin G C 8: 110,538,375 R2730P probably benign Het
I830077J02Rik T C 3: 105,926,514 N109D possibly damaging Het
Igf2r A T 17: 12,703,376 F1284I probably damaging Het
Ildr2 C G 1: 166,270,575 D167E probably damaging Het
Ipo9 T C 1: 135,386,308 D949G probably benign Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Itpr1 A G 6: 108,388,192 N27S probably damaging Het
Klra4 C A 6: 130,065,199 R35L probably benign Het
Map3k2 T A 18: 32,226,629 C512S probably benign Het
Mertk A G 2: 128,759,230 probably null Het
Mgat2 T A 12: 69,185,633 I327N probably damaging Het
Mogat1 T C 1: 78,522,859 I59T probably damaging Het
Mrpl2 A T 17: 46,647,456 M55L probably benign Het
Nxpe3 T C 16: 55,844,322 M512V possibly damaging Het
Pcdh15 T C 10: 74,450,220 L769P probably damaging Het
Pcmtd2 T G 2: 181,844,438 V117G probably damaging Het
Pdia2 A T 17: 26,196,604 probably null Het
Repin1 A T 6: 48,597,925 Q593L possibly damaging Het
Rnf213 C T 11: 119,449,866 T3517I probably benign Het
Rxfp2 A T 5: 150,018,745 probably benign Het
Skint8 T C 4: 111,928,771 L138P probably damaging Het
Slc35a3 T A 3: 116,712,768 Q5L probably null Het
Sulf1 T A 1: 12,838,434 I557N probably damaging Het
Tbc1d8 T C 1: 39,389,374 I497V possibly damaging Het
Ticam2 A C 18: 46,560,931 S30A probably benign Het
Timp3 T C 10: 86,345,774 S170P possibly damaging Het
Top1mt C T 15: 75,676,124 E38K probably benign Het
Tpp1 G A 7: 105,748,964 L331F probably damaging Het
Trpm7 A T 2: 126,813,021 D1332E probably benign Het
Ttc23 A G 7: 67,669,728 E112G possibly damaging Het
Ttn T C 2: 76,884,952 probably benign Het
Ttn T A 2: 76,896,590 probably benign Het
Ubr3 T A 2: 70,020,625 C1796S probably damaging Het
Ugt2b34 C T 5: 86,892,816 V416I probably benign Het
Uqcrb A G 13: 66,900,763 probably benign Het
Vps26b A G 9: 27,010,464 L255P probably benign Het
Wdr59 A G 8: 111,496,880 V154A probably damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 unclassified probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 unclassified probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 unclassified probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 unclassified probably null
R1550:Stab2 UTSW 10 86878926 missense probably benign 0.01
R1616:Stab2 UTSW 10 86885718 unclassified probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1772:Stab2 UTSW 10 86954234 missense probably benign 0.06
R1776:Stab2 UTSW 10 86957816 missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1957:Stab2 UTSW 10 86861470 missense probably benign 0.13
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2149:Stab2 UTSW 10 86865040 nonsense probably null
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3787:Stab2 UTSW 10 86969277 missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86907371 nonsense probably null
R4825:Stab2 UTSW 10 86947147 missense probably benign 0.08
R4865:Stab2 UTSW 10 86843500 unclassified probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4981:Stab2 UTSW 10 86960223 missense probably benign
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 unclassified probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 unclassified probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7107:Stab2 UTSW 10 86905592 missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7271:Stab2 UTSW 10 87003108 splice site probably null
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
R7336:Stab2 UTSW 10 86969185 nonsense probably null
R7432:Stab2 UTSW 10 86885683 missense probably damaging 0.99
R7580:Stab2 UTSW 10 86869164 missense probably benign 0.00
R7622:Stab2 UTSW 10 86873902 missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86883782 critical splice donor site probably null
R7658:Stab2 UTSW 10 86981135 missense probably benign 0.12
R7798:Stab2 UTSW 10 86957912 missense probably damaging 0.98
R7835:Stab2 UTSW 10 86872619 missense probably benign 0.06
R7845:Stab2 UTSW 10 86996894 missense probably benign 0.09
R7863:Stab2 UTSW 10 86972881 missense probably benign 0.30
R7885:Stab2 UTSW 10 86878912 missense probably benign 0.03
R7904:Stab2 UTSW 10 86954192 nonsense probably null
R7918:Stab2 UTSW 10 86872619 missense probably benign 0.06
R7928:Stab2 UTSW 10 86996894 missense probably benign 0.09
R7946:Stab2 UTSW 10 86972881 missense probably benign 0.30
R7968:Stab2 UTSW 10 86878912 missense probably benign 0.03
R7987:Stab2 UTSW 10 86954192 nonsense probably null
R8014:Stab2 UTSW 10 86850903 missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86905539 missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86846052 missense probably benign 0.34
RF061:Stab2 UTSW 10 86866758 critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86949914 missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86896596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTGCAGATATTCCCTG -3'
(R):5'- AGACATCCGACAGATTGGTGG -3'

Sequencing Primer
(F):5'- GATATTCCCTGCTTCAGTAACAGAC -3'
(R):5'- CTAGCCAGTTCATCAGAAGGATTGC -3'
Posted On2018-10-18