Incidental Mutation 'R6841:Rnf213'

• ID: 538045
• Institutional Source: Beutler Lab
• Gene Symbol: Rnf213
• Ensembl Gene: ENSMUSG00000070327
• Gene Name: ring finger protein 213
• Synonyms: D11Ertd759e
• MMRRC Submission: 044947-MU
• Essential gene?: Non essential (E-score: 0.000)
• Stock #: R6841 (G1)
• Quality Score: 225.009
• Status: Validated
• Chromosome: 11
• Chromosomal Location: 119393100-119487418 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): C to T at 119449866 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Threonine to Isoleucine at position 3517 (T3517I)
• Ref Sequence: ENSEMBL: ENSMUSP00000115063
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
• AlphaFold: no structure available at present
• Predicted Effect: probably benign; Transcript: ENSMUST00000093902; AA Change: T3518I; PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
• SMART Domains: Protein: ENSMUSP00000091429; Gene: ENSMUSG00000070327; AA Change: T3518I

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

• Predicted Effect: probably benign; Transcript: ENSMUST00000131035; AA Change: T3517I; PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
• SMART Domains: Protein: ENSMUSP00000115063; Gene: ENSMUSG00000070327; AA Change: T3517I

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
• Validation Efficiency: 99% (71/72)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
• Allele List at MGI:

  All alleles(13) : Targeted, other(2) Gene trapped(11)

• Posted On: 2018-10-18

Predicted Primers

PCR Primer
(F):5'- CAGACTGGAATCAGCACAGTAG -3'
(R):5'- ACAGGGCCTGTTTTGTCAGC -3'

Sequencing Primer
(F):5'- CTGGAATCAGCACAGTAGAATTC -3'
(R):5'- GTTCTTGACACAACTTACCCAAGAGG -3'