Incidental Mutation 'R6841:Has1'
ID538057
Institutional Source Beutler Lab
Gene Symbol Has1
Ensembl Gene ENSMUSG00000003665
Gene Namehyaluronan synthase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6841 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location17843323-17855205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17843860 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 506 (V506I)
Ref Sequence ENSEMBL: ENSMUSP00000003762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003762] [ENSMUST00000139969] [ENSMUST00000172097] [ENSMUST00000226899] [ENSMUST00000228490]
Predicted Effect probably benign
Transcript: ENSMUST00000003762
AA Change: V506I

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000003762
Gene: ENSMUSG00000003665
AA Change: V506I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
low complexity region 78 86 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 179 387 1.1e-21 PFAM
Pfam:Glyco_transf_21 205 386 1.2e-8 PFAM
Pfam:Chitin_synth_2 222 394 1.6e-16 PFAM
Pfam:Glyco_trans_2_3 237 453 5.6e-16 PFAM
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 544 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139969
SMART Domains Protein: ENSMUSP00000119658
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG 151 186 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154301
SMART Domains Protein: ENSMUSP00000117377
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
Blast:IG 27 78 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172097
SMART Domains Protein: ENSMUSP00000128732
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IG 171 260 2.08e-1 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226899
Predicted Effect probably benign
Transcript: ENSMUST00000228490
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS1 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to the hasA gene product of Streptococcus pyogenes, a glycosaminoglycan synthetase (DG42) from Xenopus laevis, and a recently described murine hyaluronan synthase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and appear grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T C 14: 49,243,813 probably null Het
4932438A13Rik A G 3: 37,021,481 Y3610C probably damaging Het
A730071L15Rik G A 11: 6,200,439 W137* probably null Het
Acads G A 5: 115,112,358 T169I probably benign Het
Adgrg7 T A 16: 56,750,424 N414Y probably damaging Het
Ankrd35 T A 3: 96,670,426 S6T probably damaging Het
Armc3 A G 2: 19,201,819 probably null Het
Atp9a C A 2: 168,654,220 V555F possibly damaging Het
Cars2 C T 8: 11,516,198 V443I probably benign Het
Cblc A G 7: 19,792,896 L137P probably damaging Het
Cdk5r1 T A 11: 80,478,195 C229* probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Cfap54 T C 10: 92,875,015 Y2728C unknown Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
Cnot11 C T 1: 39,540,067 Q12* probably null Het
Commd6 A T 14: 101,637,098 D19E probably damaging Het
Crygc C T 1: 65,073,202 G71D possibly damaging Het
Cstf3 A G 2: 104,655,731 K439E probably benign Het
Cyp11b2 G T 15: 74,855,491 H114N probably benign Het
Cyp2d40 T C 15: 82,761,486 D106G probably benign Het
Dhx8 T A 11: 101,764,792 V1117E probably damaging Het
Duoxa1 G T 2: 122,303,981 L219I probably damaging Het
Dynap A T 18: 70,241,182 I91N probably damaging Het
Elfn1 G T 5: 139,973,145 G635W probably damaging Het
Fan1 A T 7: 64,364,629 I618N probably damaging Het
Fras1 A G 5: 96,728,551 D2381G probably damaging Het
Fxyd6 T A 9: 45,391,553 probably null Het
Gpr137b A T 13: 13,363,509 W286R probably damaging Het
Gpsm3 A T 17: 34,590,562 probably null Het
Hoxd10 T A 2: 74,692,272 V98D probably benign Het
Htr2b T A 1: 86,099,893 D297V probably benign Het
Hydin G C 8: 110,538,375 R2730P probably benign Het
I830077J02Rik T C 3: 105,926,514 N109D possibly damaging Het
Igf2r A T 17: 12,703,376 F1284I probably damaging Het
Ildr2 C G 1: 166,270,575 D167E probably damaging Het
Ipo9 T C 1: 135,386,308 D949G probably benign Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Itpr1 A G 6: 108,388,192 N27S probably damaging Het
Klra4 C A 6: 130,065,199 R35L probably benign Het
Map3k2 T A 18: 32,226,629 C512S probably benign Het
Mertk A G 2: 128,759,230 probably null Het
Mgat2 T A 12: 69,185,633 I327N probably damaging Het
Mogat1 T C 1: 78,522,859 I59T probably damaging Het
Mrpl2 A T 17: 46,647,456 M55L probably benign Het
Nxpe3 T C 16: 55,844,322 M512V possibly damaging Het
Pcdh15 T C 10: 74,450,220 L769P probably damaging Het
Pcmtd2 T G 2: 181,844,438 V117G probably damaging Het
Pdia2 A T 17: 26,196,604 probably null Het
Repin1 A T 6: 48,597,925 Q593L possibly damaging Het
Rnf213 C T 11: 119,449,866 T3517I probably benign Het
Rxfp2 A T 5: 150,018,745 probably benign Het
Skint8 T C 4: 111,928,771 L138P probably damaging Het
Slc35a3 T A 3: 116,712,768 Q5L probably null Het
Stab2 T A 10: 86,942,190 N758I probably damaging Het
Sulf1 T A 1: 12,838,434 I557N probably damaging Het
Tbc1d8 T C 1: 39,389,374 I497V possibly damaging Het
Ticam2 A C 18: 46,560,931 S30A probably benign Het
Timp3 T C 10: 86,345,774 S170P possibly damaging Het
Top1mt C T 15: 75,676,124 E38K probably benign Het
Tpp1 G A 7: 105,748,964 L331F probably damaging Het
Trpm7 A T 2: 126,813,021 D1332E probably benign Het
Ttc23 A G 7: 67,669,728 E112G possibly damaging Het
Ttn T C 2: 76,884,952 probably benign Het
Ttn T A 2: 76,896,590 probably benign Het
Ubr3 T A 2: 70,020,625 C1796S probably damaging Het
Ugt2b34 C T 5: 86,892,816 V416I probably benign Het
Uqcrb A G 13: 66,900,763 probably benign Het
Vps26b A G 9: 27,010,464 L255P probably benign Het
Wdr59 A G 8: 111,496,880 V154A probably damaging Het
Other mutations in Has1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Has1 APN 17 17843662 unclassified probably benign
IGL02551:Has1 APN 17 17848298 missense probably damaging 1.00
R0149:Has1 UTSW 17 17850171 missense probably damaging 1.00
R0496:Has1 UTSW 17 17843746 missense probably benign
R0637:Has1 UTSW 17 17843863 missense possibly damaging 0.67
R1051:Has1 UTSW 17 17848279 missense probably damaging 1.00
R1647:Has1 UTSW 17 17849985 missense probably damaging 1.00
R1648:Has1 UTSW 17 17849985 missense probably damaging 1.00
R1768:Has1 UTSW 17 17850300 missense probably benign
R2016:Has1 UTSW 17 17848270 missense probably damaging 1.00
R3810:Has1 UTSW 17 17847560 missense probably damaging 0.98
R4235:Has1 UTSW 17 17850036 missense possibly damaging 0.62
R4467:Has1 UTSW 17 17843995 missense probably benign 0.05
R5475:Has1 UTSW 17 17848321 missense possibly damaging 0.57
R5682:Has1 UTSW 17 17844163 missense possibly damaging 0.58
R6418:Has1 UTSW 17 17849945 missense probably damaging 1.00
R7076:Has1 UTSW 17 17843806 missense probably damaging 1.00
R7767:Has1 UTSW 17 17850530 missense probably damaging 1.00
X0028:Has1 UTSW 17 17850453 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTAACATTACCACCCAGTAGGC -3'
(R):5'- TGAGGCTCTTCTATGCAGGG -3'

Sequencing Primer
(F):5'- ACCCAGTAGGCCACATAGG -3'
(R):5'- CGTAGCACTGGCAAAGGC -3'
Posted On2018-10-18