Incidental Mutation 'R6841:Pdia2'
ID538058
Institutional Source Beutler Lab
Gene Symbol Pdia2
Ensembl Gene ENSMUSG00000024184
Gene Nameprotein disulfide isomerase associated 2
SynonymsPdipl, 1810041F13Rik, Pdip
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6841 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26195999-26199087 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 26196604 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000025019] [ENSMUST00000039113] [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000120333] [ENSMUST00000121959] [ENSMUST00000163421] [ENSMUST00000176961]
Predicted Effect probably benign
Transcript: ENSMUST00000025019
SMART Domains Protein: ENSMUSP00000025019
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
Pfam:Rho_GDI 29 222 1.2e-60 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000039113
SMART Domains Protein: ENSMUSP00000035584
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 1.5e-26 PFAM
Pfam:Thioredoxin_6 182 369 3.2e-37 PFAM
Pfam:Thioredoxin 392 497 2.4e-27 PFAM
low complexity region 501 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074370
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118904
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120333
SMART Domains Protein: ENSMUSP00000114080
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 2.6e-27 PFAM
Pfam:Thioredoxin_6 181 366 2e-37 PFAM
Pfam:Thioredoxin 389 494 7.2e-28 PFAM
low complexity region 498 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121959
SMART Domains Protein: ENSMUSP00000113186
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 197 6.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142410
SMART Domains Protein: ENSMUSP00000115267
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
Pfam:Thioredoxin 38 145 3.8e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148134
SMART Domains Protein: ENSMUSP00000116340
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
Pfam:Thioredoxin 19 124 2e-28 PFAM
low complexity region 128 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163421
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176961
SMART Domains Protein: ENSMUSP00000135717
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 222 1.9e-83 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, two catalytically active thioredoxin (TRX) domains, two TRX-like domains and a C-terminal ER-retention sequence. The protein plays a role in the folding of nascent proteins in the endoplasmic reticulum by forming disulfide bonds through its thiol isomerase, oxidase, and reductase activity. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T C 14: 49,243,813 probably null Het
4932438A13Rik A G 3: 37,021,481 Y3610C probably damaging Het
A730071L15Rik G A 11: 6,200,439 W137* probably null Het
Acads G A 5: 115,112,358 T169I probably benign Het
Adgrg7 T A 16: 56,750,424 N414Y probably damaging Het
Ankrd35 T A 3: 96,670,426 S6T probably damaging Het
Armc3 A G 2: 19,201,819 probably null Het
Atp9a C A 2: 168,654,220 V555F possibly damaging Het
Cars2 C T 8: 11,516,198 V443I probably benign Het
Cblc A G 7: 19,792,896 L137P probably damaging Het
Cdk5r1 T A 11: 80,478,195 C229* probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Cfap54 T C 10: 92,875,015 Y2728C unknown Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
Cnot11 C T 1: 39,540,067 Q12* probably null Het
Commd6 A T 14: 101,637,098 D19E probably damaging Het
Crygc C T 1: 65,073,202 G71D possibly damaging Het
Cstf3 A G 2: 104,655,731 K439E probably benign Het
Cyp11b2 G T 15: 74,855,491 H114N probably benign Het
Cyp2d40 T C 15: 82,761,486 D106G probably benign Het
Dhx8 T A 11: 101,764,792 V1117E probably damaging Het
Duoxa1 G T 2: 122,303,981 L219I probably damaging Het
Dynap A T 18: 70,241,182 I91N probably damaging Het
Elfn1 G T 5: 139,973,145 G635W probably damaging Het
Fan1 A T 7: 64,364,629 I618N probably damaging Het
Fras1 A G 5: 96,728,551 D2381G probably damaging Het
Fxyd6 T A 9: 45,391,553 probably null Het
Gpr137b A T 13: 13,363,509 W286R probably damaging Het
Gpsm3 A T 17: 34,590,562 probably null Het
Has1 C T 17: 17,843,860 V506I probably benign Het
Hoxd10 T A 2: 74,692,272 V98D probably benign Het
Htr2b T A 1: 86,099,893 D297V probably benign Het
Hydin G C 8: 110,538,375 R2730P probably benign Het
I830077J02Rik T C 3: 105,926,514 N109D possibly damaging Het
Igf2r A T 17: 12,703,376 F1284I probably damaging Het
Ildr2 C G 1: 166,270,575 D167E probably damaging Het
Ipo9 T C 1: 135,386,308 D949G probably benign Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Itpr1 A G 6: 108,388,192 N27S probably damaging Het
Klra4 C A 6: 130,065,199 R35L probably benign Het
Map3k2 T A 18: 32,226,629 C512S probably benign Het
Mertk A G 2: 128,759,230 probably null Het
Mgat2 T A 12: 69,185,633 I327N probably damaging Het
Mogat1 T C 1: 78,522,859 I59T probably damaging Het
Mrpl2 A T 17: 46,647,456 M55L probably benign Het
Nxpe3 T C 16: 55,844,322 M512V possibly damaging Het
Pcdh15 T C 10: 74,450,220 L769P probably damaging Het
Pcmtd2 T G 2: 181,844,438 V117G probably damaging Het
Repin1 A T 6: 48,597,925 Q593L possibly damaging Het
Rnf213 C T 11: 119,449,866 T3517I probably benign Het
Rxfp2 A T 5: 150,018,745 probably benign Het
Skint8 T C 4: 111,928,771 L138P probably damaging Het
Slc35a3 T A 3: 116,712,768 Q5L probably null Het
Stab2 T A 10: 86,942,190 N758I probably damaging Het
Sulf1 T A 1: 12,838,434 I557N probably damaging Het
Tbc1d8 T C 1: 39,389,374 I497V possibly damaging Het
Ticam2 A C 18: 46,560,931 S30A probably benign Het
Timp3 T C 10: 86,345,774 S170P possibly damaging Het
Top1mt C T 15: 75,676,124 E38K probably benign Het
Tpp1 G A 7: 105,748,964 L331F probably damaging Het
Trpm7 A T 2: 126,813,021 D1332E probably benign Het
Ttc23 A G 7: 67,669,728 E112G possibly damaging Het
Ttn T C 2: 76,884,952 probably benign Het
Ttn T A 2: 76,896,590 probably benign Het
Ubr3 T A 2: 70,020,625 C1796S probably damaging Het
Ugt2b34 C T 5: 86,892,816 V416I probably benign Het
Uqcrb A G 13: 66,900,763 probably benign Het
Vps26b A G 9: 27,010,464 L255P probably benign Het
Wdr59 A G 8: 111,496,880 V154A probably damaging Het
Other mutations in Pdia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pdia2 APN 17 26198116 missense probably damaging 0.98
IGL01019:Pdia2 APN 17 26198922 missense probably damaging 1.00
IGL02289:Pdia2 APN 17 26197890 missense possibly damaging 0.66
IGL02725:Pdia2 APN 17 26196532 missense probably benign 0.05
R0553:Pdia2 UTSW 17 26196243 missense probably damaging 0.98
R0988:Pdia2 UTSW 17 26198829 missense probably damaging 1.00
R1624:Pdia2 UTSW 17 26196521 missense probably damaging 1.00
R1917:Pdia2 UTSW 17 26198105 missense possibly damaging 0.82
R3950:Pdia2 UTSW 17 26197616 critical splice donor site probably null
R4583:Pdia2 UTSW 17 26196502 missense probably damaging 1.00
R5455:Pdia2 UTSW 17 26197163 missense probably null 0.99
R6889:Pdia2 UTSW 17 26196970 nonsense probably null
R7312:Pdia2 UTSW 17 26197660 missense possibly damaging 0.72
R7743:Pdia2 UTSW 17 26198868 missense probably benign 0.00
R7897:Pdia2 UTSW 17 26198233 missense probably benign
R7980:Pdia2 UTSW 17 26198233 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTGCAGGAAAGAACTTGAG -3'
(R):5'- ACAGCAGTCCTAGGTCTCTG -3'

Sequencing Primer
(F):5'- CTTGAGAGTGGGATAGCCG -3'
(R):5'- TGAGTCAGGAGATACCCCCTG -3'
Posted On2018-10-18