Incidental Mutation 'R6465:A2ml1'
ID538071
Institutional Source Beutler Lab
Gene Symbol A2ml1
Ensembl Gene ENSMUSG00000047228
Gene Namealpha-2-macroglobulin like 1
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location128539821-128581608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128541078 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1415 (T1415I)
Ref Sequence ENSEMBL: ENSMUSP00000059426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060574]
Predicted Effect probably damaging
Transcript: ENSMUST00000060574
AA Change: T1415I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: T1415I

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
Pfam:A2M_N 120 213 6.3e-17 PFAM
A2M_N_2 448 594 2.95e-37 SMART
A2M 736 826 2.11e-33 SMART
Pfam:Thiol-ester_cl 959 988 3.1e-17 PFAM
Pfam:A2M_comp 1008 1255 2.3e-71 PFAM
A2M_recep 1361 1447 1.22e-29 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Haghl T C 17: 25,783,819 N190S possibly damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in A2ml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:A2ml1 APN 6 128578156 missense possibly damaging 0.78
IGL00596:A2ml1 APN 6 128570067 missense probably damaging 0.99
IGL00912:A2ml1 APN 6 128552307 missense probably benign 0.04
IGL01320:A2ml1 APN 6 128575588 missense probably benign 0.00
IGL01470:A2ml1 APN 6 128580412 missense probably damaging 0.96
IGL01576:A2ml1 APN 6 128554330 splice site probably benign
IGL01761:A2ml1 APN 6 128546337 missense possibly damaging 0.61
IGL01792:A2ml1 APN 6 128560679 missense probably benign 0.04
IGL01843:A2ml1 APN 6 128553338 splice site probably benign
IGL01946:A2ml1 APN 6 128570479 missense possibly damaging 0.81
IGL02016:A2ml1 APN 6 128558335 missense probably damaging 1.00
IGL02170:A2ml1 APN 6 128547210 missense possibly damaging 0.58
IGL02269:A2ml1 APN 6 128553338 splice site probably benign
IGL02589:A2ml1 APN 6 128581500 missense probably benign 0.00
IGL02959:A2ml1 APN 6 128567060 missense probably benign 0.04
IGL02970:A2ml1 APN 6 128569979 missense probably damaging 1.00
IGL03206:A2ml1 APN 6 128553276 missense possibly damaging 0.50
IGL03298:A2ml1 APN 6 128543960 missense probably benign 0.00
1mM(1):A2ml1 UTSW 6 128580960 missense probably benign 0.02
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0128:A2ml1 UTSW 6 128575639 splice site probably benign
R0299:A2ml1 UTSW 6 128553232 splice site probably benign
R0523:A2ml1 UTSW 6 128558326 missense possibly damaging 0.92
R0565:A2ml1 UTSW 6 128568743 nonsense probably null
R0599:A2ml1 UTSW 6 128552245 missense probably damaging 1.00
R0626:A2ml1 UTSW 6 128550773 missense probably damaging 0.99
R0732:A2ml1 UTSW 6 128546448 missense probably damaging 1.00
R0880:A2ml1 UTSW 6 128560646 missense possibly damaging 0.49
R1070:A2ml1 UTSW 6 128543300 missense probably damaging 1.00
R1166:A2ml1 UTSW 6 128570917 missense probably benign 0.00
R1278:A2ml1 UTSW 6 128558507 missense probably damaging 1.00
R1421:A2ml1 UTSW 6 128543960 missense probably benign 0.00
R1536:A2ml1 UTSW 6 128547233 nonsense probably null
R1786:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R1808:A2ml1 UTSW 6 128543299 missense probably damaging 1.00
R1813:A2ml1 UTSW 6 128566273 missense probably benign 0.34
R1863:A2ml1 UTSW 6 128550783 missense probably damaging 0.99
R2007:A2ml1 UTSW 6 128542892 missense probably benign 0.13
R2062:A2ml1 UTSW 6 128552308 missense probably benign 0.08
R2127:A2ml1 UTSW 6 128558437 missense probably damaging 1.00
R2130:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2131:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2201:A2ml1 UTSW 6 128547305 missense probably null 0.34
R2319:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2321:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2322:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2369:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2370:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2371:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2372:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2375:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2893:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2894:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3438:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3615:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3616:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3773:A2ml1 UTSW 6 128555083 missense probably benign 0.02
R3785:A2ml1 UTSW 6 128544924 critical splice donor site probably null
R3803:A2ml1 UTSW 6 128545070 missense probably benign 0.17
R3824:A2ml1 UTSW 6 128568763 missense probably damaging 0.99
R3878:A2ml1 UTSW 6 128554361 missense probably benign 0.05
R4176:A2ml1 UTSW 6 128545037 missense possibly damaging 0.68
R4229:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4230:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4348:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4351:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4352:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4353:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4427:A2ml1 UTSW 6 128545046 missense probably benign 0.00
R4971:A2ml1 UTSW 6 128547227 missense probably damaging 0.98
R5014:A2ml1 UTSW 6 128543933 missense probably benign 0.00
R5369:A2ml1 UTSW 6 128568833 missense probably damaging 0.97
R5532:A2ml1 UTSW 6 128553330 critical splice acceptor site probably null
R5860:A2ml1 UTSW 6 128541061 missense probably benign 0.15
R5872:A2ml1 UTSW 6 128561526 missense probably damaging 1.00
R5926:A2ml1 UTSW 6 128560645 missense probably benign
R5977:A2ml1 UTSW 6 128581122 missense probably damaging 1.00
R5980:A2ml1 UTSW 6 128567055 missense possibly damaging 0.82
R6014:A2ml1 UTSW 6 128571985 missense probably damaging 1.00
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6061:A2ml1 UTSW 6 128568712 missense probably damaging 1.00
R6327:A2ml1 UTSW 6 128558692 splice site probably null
R6331:A2ml1 UTSW 6 128552236 missense probably damaging 0.96
R6640:A2ml1 UTSW 6 128553285 missense probably benign 0.41
R6792:A2ml1 UTSW 6 128546329 nonsense probably null
R6793:A2ml1 UTSW 6 128546329 nonsense probably null
R7207:A2ml1 UTSW 6 128550771 missense probably benign 0.04
R7378:A2ml1 UTSW 6 128546247 critical splice donor site probably null
R7556:A2ml1 UTSW 6 128569964 missense probably damaging 1.00
R8010:A2ml1 UTSW 6 128580340 missense probably benign 0.08
R8017:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8019:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8035:A2ml1 UTSW 6 128553280 missense probably damaging 0.99
R8094:A2ml1 UTSW 6 128572082 missense probably damaging 1.00
R8144:A2ml1 UTSW 6 128569999 missense possibly damaging 0.84
R8365:A2ml1 UTSW 6 128580955 nonsense probably null
R8382:A2ml1 UTSW 6 128560682 missense probably benign 0.01
R8388:A2ml1 UTSW 6 128571974 missense probably benign 0.03
R8717:A2ml1 UTSW 6 128566995 missense probably benign 0.00
RF014:A2ml1 UTSW 6 128570068 missense probably damaging 0.96
X0063:A2ml1 UTSW 6 128572012 missense probably benign
Z1176:A2ml1 UTSW 6 128571977 missense probably benign 0.09
Z1177:A2ml1 UTSW 6 128545076 missense probably benign
Z1177:A2ml1 UTSW 6 128561616 nonsense probably null
Z1177:A2ml1 UTSW 6 128575607 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CATGAAACCATCGCTTGTTCAC -3'
(R):5'- CCTTAATATGAGCAGTGCAGC -3'

Sequencing Primer
(F):5'- CATCGCTTGTTCACTTTTTGAAGATG -3'
(R):5'- GAGCAGTGCAGCTTAAATGTTTAC -3'
Posted On2018-10-26