Incidental Mutation 'R6388:Ube3a'
ID538074
Institutional Source Beutler Lab
Gene Symbol Ube3a
Ensembl Gene ENSMUSG00000025326
Gene Nameubiquitin protein ligase E3A
SynonymsHpve6a, 5830462N02Rik, E6-AP ubiquitin protein ligase, A130086L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R6388 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location59228750-59311536 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 59304921 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect probably null
Transcript: ENSMUST00000202247
Predicted Effect probably null
Transcript: ENSMUST00000202288
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase, part of the ubiquitin protein degradation system. This imprinted gene is maternally expressed in brain and biallelically expressed in other tissues. Maternally inherited deletion of this gene causes Angelman Syndrome, characterized by severe motor and intellectual retardation, ataxia, hypotonia, epilepsy, absence of speech, and characteristic facies. The protein also interacts with the E6 protein of human papillomavirus types 16 and 18, resulting in ubiquitination and proteolysis of tumor protein p53. Alternative splicing of this gene results in three transcript variants encoding three isoforms with different N-termini. Additional transcript variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with maternally inherited targeted null mutations exhibit reduced brain weight, impaired motor function, inducible seizures, learning deficits, abnormal hippocampal electroencephalographic recordings, and severely impaired long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,262,111 R560W probably benign Het
Abi3 A G 11: 95,833,638 probably null Het
Ap1b1 T C 11: 5,026,319 I449T probably damaging Het
Atpaf2 C A 11: 60,417,007 probably benign Het
Car5a T C 8: 121,927,171 Y118C probably damaging Het
Ccdc18 A G 5: 108,201,348 D1002G possibly damaging Het
Ciao1 A T 2: 127,246,476 C142* probably null Het
Clec14a A G 12: 58,267,457 *460R probably null Het
Defb30 T A 14: 63,049,764 probably benign Het
Dnah10 A G 5: 124,829,646 K4247R probably benign Het
Eif5b G A 1: 38,019,000 A128T unknown Het
Fam3b T C 16: 97,478,391 T113A probably benign Het
Fam98c C T 7: 29,155,303 R126Q probably damaging Het
Fastkd3 C T 13: 68,590,200 L623F probably damaging Het
Golga1 T C 2: 39,023,171 D543G probably benign Het
Gpatch8 A T 11: 102,478,488 V1408E probably damaging Het
Icosl T A 10: 78,069,532 L3Q possibly damaging Homo
Igf2r A G 17: 12,683,900 V2421A probably benign Het
Iglon5 T C 7: 43,478,132 T165A possibly damaging Het
Map3k11 A G 19: 5,690,251 E2G probably damaging Het
Nipbl A T 15: 8,300,784 C2386S probably damaging Het
Nos1 A G 5: 117,914,436 E837G possibly damaging Het
Npc1l1 T C 11: 6,224,145 E720G probably damaging Het
Olfr395 A G 11: 73,907,292 S67P probably damaging Het
Pla1a T A 16: 38,397,472 M385L probably benign Het
Ppp1r32 A G 19: 10,482,301 V14A probably damaging Het
Setdb2 T C 14: 59,424,697 T82A probably benign Het
Smarcd3 A G 5: 24,596,026 F128L possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syvn1 T A 19: 6,052,351 V483E probably damaging Het
Timm22 G A 11: 76,407,119 V19I probably benign Het
Ttn C A 2: 76,790,845 D15716Y probably damaging Het
Ugp2 A G 11: 21,322,051 probably null Het
Vmn1r13 T A 6: 57,209,918 F21I probably benign Het
Vps13d T C 4: 145,155,574 S1150G probably benign Het
Zp3 T C 5: 135,982,694 V122A probably benign Het
Other mutations in Ube3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Ube3a APN 7 59272110 missense probably damaging 1.00
IGL00886:Ube3a APN 7 59284737 missense probably damaging 1.00
IGL02037:Ube3a APN 7 59275758 unclassified probably benign
IGL02127:Ube3a APN 7 59276041 missense probably benign 0.03
IGL02228:Ube3a APN 7 59288396 splice site probably benign
IGL02533:Ube3a APN 7 59304832 missense probably damaging 1.00
IGL02706:Ube3a APN 7 59272133 missense possibly damaging 0.67
IGL03037:Ube3a APN 7 59247223 splice site probably benign
IGL03213:Ube3a APN 7 59286122 nonsense probably null
IGL03306:Ube3a APN 7 59286147 missense probably damaging 1.00
Kebab UTSW 7 59288488 missense probably damaging 1.00
Shawarma UTSW 7 59276183 nonsense probably null
PIT4362001:Ube3a UTSW 7 59276122 missense possibly damaging 0.86
R0847:Ube3a UTSW 7 59276586 missense possibly damaging 0.80
R1765:Ube3a UTSW 7 59286114 missense probably damaging 1.00
R1771:Ube3a UTSW 7 59275966 missense probably damaging 1.00
R1926:Ube3a UTSW 7 59276379 missense probably damaging 1.00
R1992:Ube3a UTSW 7 59303787 missense probably damaging 1.00
R2026:Ube3a UTSW 7 59303726 missense probably damaging 1.00
R2104:Ube3a UTSW 7 59276477 missense possibly damaging 0.95
R3176:Ube3a UTSW 7 59276519 nonsense probably null
R3276:Ube3a UTSW 7 59276519 nonsense probably null
R3623:Ube3a UTSW 7 59272112 missense probably damaging 1.00
R3624:Ube3a UTSW 7 59272112 missense probably damaging 1.00
R3690:Ube3a UTSW 7 59276799 missense probably damaging 1.00
R4423:Ube3a UTSW 7 59276113 missense probably benign 0.10
R4583:Ube3a UTSW 7 59286063 missense probably damaging 1.00
R4883:Ube3a UTSW 7 59243450 start codon destroyed probably benign 0.21
R4992:Ube3a UTSW 7 59284820 missense possibly damaging 0.47
R5175:Ube3a UTSW 7 59288717 missense probably damaging 1.00
R5397:Ube3a UTSW 7 59286912 missense probably benign 0.26
R5545:Ube3a UTSW 7 59272024 missense probably damaging 1.00
R5572:Ube3a UTSW 7 59288777 missense probably damaging 1.00
R5635:Ube3a UTSW 7 59288488 missense probably damaging 1.00
R5766:Ube3a UTSW 7 59276059 missense possibly damaging 0.89
R5890:Ube3a UTSW 7 59272028 missense probably damaging 1.00
R5956:Ube3a UTSW 7 59277020 unclassified probably benign
R6464:Ube3a UTSW 7 59276183 nonsense probably null
R6467:Ube3a UTSW 7 59276902 missense probably damaging 1.00
R6474:Ube3a UTSW 7 59287024 missense probably damaging 1.00
R6669:Ube3a UTSW 7 59276857 missense probably benign 0.02
R7003:Ube3a UTSW 7 59276440 missense probably damaging 1.00
R7044:Ube3a UTSW 7 59288413 missense probably damaging 1.00
R7187:Ube3a UTSW 7 59275905 missense probably benign 0.02
R7360:Ube3a UTSW 7 59276635 missense probably damaging 1.00
R7363:Ube3a UTSW 7 59287003 missense probably benign 0.00
R7508:Ube3a UTSW 7 59303689 missense possibly damaging 0.84
R7652:Ube3a UTSW 7 59243354 start gained probably benign
R7768:Ube3a UTSW 7 59288777 missense probably damaging 1.00
R8015:Ube3a UTSW 7 59284756 missense probably damaging 1.00
R8044:Ube3a UTSW 7 59276572 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CACTGAGCATATTTCCAATGACTC -3'
(R):5'- ACCTCTCTGTACATACAAGTGAAAG -3'

Sequencing Primer
(F):5'- CCAATGACTCATGATTGTCCTG -3'
(R):5'- AGCTGAAATCTGCTGTTCCAG -3'
Posted On2018-10-31