Incidental Mutation 'R6466:Nfat5'
ID538079
Institutional Source Beutler Lab
Gene Symbol Nfat5
Ensembl Gene ENSMUSG00000003847
Gene Namenuclear factor of activated T cells 5
SynonymsOREBP, nfatz, TonEBP, B130038B15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R6466 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location107293470-107379517 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 107355508 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075922] [ENSMUST00000077440] [ENSMUST00000125721] [ENSMUST00000151114] [ENSMUST00000169453]
Predicted Effect probably null
Transcript: ENSMUST00000075922
SMART Domains Protein: ENSMUSP00000075311
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 7.8e-23 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077440
SMART Domains Protein: ENSMUSP00000076653
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 103 116 N/A INTRINSIC
Pfam:RHD 206 363 1.5e-22 PFAM
IPT 368 466 3.33e-15 SMART
low complexity region 571 577 N/A INTRINSIC
low complexity region 658 678 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 839 844 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
internal_repeat_2 927 1110 7.13e-8 PROSPERO
internal_repeat_1 935 1128 2.59e-11 PROSPERO
internal_repeat_2 1122 1324 7.13e-8 PROSPERO
internal_repeat_1 1207 1426 2.59e-11 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000125721
SMART Domains Protein: ENSMUSP00000116094
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 1e-22 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
internal_repeat_2 1003 1186 2.22e-8 PROSPERO
internal_repeat_1 1011 1204 5.31e-12 PROSPERO
internal_repeat_2 1198 1400 2.22e-8 PROSPERO
internal_repeat_1 1283 1502 5.31e-12 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000151114
SMART Domains Protein: ENSMUSP00000119370
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000169453
SMART Domains Protein: ENSMUSP00000127784
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells family of transcription factors. Proteins belonging to this family play a central role in inducible gene transcription during the immune response. This protein regulates gene expression induced by osmotic stress in mammalian cells. Unlike monomeric members of this protein family, this protein exists as a homodimer and forms stable dimers with DNA elements. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one of several knock-out allele exhibit lethality between E14.5 and E17.5 as well as around P10 with kidney, cardiac or immune defects depending on the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 120,608,996 D69E probably damaging Het
Adgrv1 G T 13: 81,575,101 probably null Het
Ahr A T 12: 35,504,032 V696E probably benign Het
Akap13 A G 7: 75,727,044 T2007A probably benign Het
Arid1b T C 17: 5,327,678 F753S probably damaging Het
BC055324 G T 1: 163,954,165 R898S probably benign Het
Bpifb3 G T 2: 153,922,188 K105N probably damaging Het
C2cd2 A G 16: 97,879,622 C331R probably benign Het
Chrm1 T A 19: 8,678,178 Y82* probably null Het
Clcn3 A C 8: 60,929,561 V331G probably damaging Het
Dchs1 A T 7: 105,764,541 D1022E probably benign Het
Dnah2 T A 11: 69,539,415 T106S probably benign Het
Fam171a2 T A 11: 102,439,885 D256V probably damaging Het
Fmn2 T A 1: 174,609,583 probably benign Het
Fut11 C T 14: 20,695,309 R103W probably damaging Het
Gas2l2 A C 11: 83,429,353 S26A probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gramd1a A T 7: 31,143,796 I29N probably benign Het
Grem2 A G 1: 174,836,884 V133A probably damaging Het
Hydin T A 8: 110,506,968 S1813T possibly damaging Het
Igkv3-2 T C 6: 70,699,039 F111L probably benign Het
Ints8 T C 4: 11,252,878 Q68R probably damaging Het
Irx5 A G 8: 92,359,726 I146V probably damaging Het
Kcnh3 T C 15: 99,238,243 L707P probably damaging Het
Kcnk4 T A 19: 6,928,297 I101F probably damaging Het
Klhl9 A G 4: 88,721,162 Y281H probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lmbr1 C T 5: 29,378,168 A9T probably benign Het
Map10 G T 8: 125,672,384 E839* probably null Het
Nectin4 C A 1: 171,386,753 A492D probably damaging Het
Olfr467 A G 7: 107,814,694 T37A probably benign Het
Plec A G 15: 76,177,884 Y2608H probably benign Het
Pold3 A G 7: 100,100,632 S42P probably benign Het
Ppp2r1a G T 17: 20,960,631 G432* probably null Het
Qk T C 17: 10,215,465 E315G probably benign Het
Rfx2 C T 17: 56,784,397 V354I probably benign Het
Rp1 T C 1: 4,347,886 Y1001C probably benign Het
Sez6l A G 5: 112,461,141 probably null Het
Slc39a14 A G 14: 70,309,886 I337T probably damaging Het
Slc3a2 G T 19: 8,709,319 L76M probably damaging Het
Slco1a5 T C 6: 142,237,534 T555A probably benign Het
Sprr2e A T 3: 92,353,034 K57N unknown Het
Syne2 A G 12: 75,943,901 T1886A probably damaging Het
Tenm3 A T 8: 48,236,063 I2147N probably damaging Het
Thbs1 G T 2: 118,119,847 G654W probably damaging Het
Tigd5 A G 15: 75,910,503 Y238C possibly damaging Het
Tmem221 A G 8: 71,557,849 F126S probably damaging Het
Trp63 C A 16: 25,763,358 P52Q probably damaging Het
Ugp2 A T 11: 21,328,883 S434R probably benign Het
Vmn2r69 A C 7: 85,407,170 F587V probably benign Het
Vps13d T A 4: 145,057,495 N3872I possibly damaging Het
Wdfy2 A G 14: 62,948,666 Y250C probably damaging Het
Zbtb16 T C 9: 48,665,319 D487G possibly damaging Het
Other mutations in Nfat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Nfat5 APN 8 107367514 missense probably damaging 1.00
IGL01145:Nfat5 APN 8 107367215 missense probably damaging 0.99
IGL01700:Nfat5 APN 8 107339130 missense probably damaging 0.99
IGL01721:Nfat5 APN 8 107344979 critical splice donor site probably null
IGL01796:Nfat5 APN 8 107367641 missense probably damaging 1.00
IGL01976:Nfat5 APN 8 107367559 missense probably damaging 1.00
IGL02063:Nfat5 APN 8 107361818 missense probably benign 0.03
IGL02150:Nfat5 APN 8 107367952 nonsense probably null
IGL02174:Nfat5 APN 8 107339051 missense probably damaging 1.00
IGL02224:Nfat5 APN 8 107344815 missense probably benign 0.00
IGL02226:Nfat5 APN 8 107351522 nonsense probably null
IGL02324:Nfat5 APN 8 107366176 splice site probably benign
IGL02724:Nfat5 APN 8 107358735 missense probably damaging 0.97
fettfeld UTSW 8 107347727 missense probably damaging 1.00
Grunefeld UTSW 8 107355508 unclassified probably null
Kleinfeld UTSW 8 107351438 missense probably damaging 1.00
H8562:Nfat5 UTSW 8 107339382 splice site probably benign
R0003:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0117:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0118:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0119:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0135:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0138:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0141:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0302:Nfat5 UTSW 8 107358701 missense probably damaging 1.00
R0420:Nfat5 UTSW 8 107367461 missense probably damaging 1.00
R0613:Nfat5 UTSW 8 107366295 missense possibly damaging 0.83
R0691:Nfat5 UTSW 8 107355605 missense probably damaging 1.00
R0743:Nfat5 UTSW 8 107368066 missense probably damaging 1.00
R1329:Nfat5 UTSW 8 107369027 missense probably benign 0.42
R1550:Nfat5 UTSW 8 107370573 missense probably damaging 0.99
R1590:Nfat5 UTSW 8 107293890 missense probably damaging 1.00
R1778:Nfat5 UTSW 8 107361789 missense probably damaging 1.00
R1827:Nfat5 UTSW 8 107367334 missense probably benign 0.00
R1918:Nfat5 UTSW 8 107366236 missense probably damaging 0.97
R2679:Nfat5 UTSW 8 107344914 missense probably damaging 1.00
R2850:Nfat5 UTSW 8 107293860 missense probably damaging 1.00
R3703:Nfat5 UTSW 8 107351421 splice site probably benign
R3966:Nfat5 UTSW 8 107367289 missense possibly damaging 0.47
R4301:Nfat5 UTSW 8 107355695 intron probably benign
R4596:Nfat5 UTSW 8 107351500 missense possibly damaging 0.93
R4602:Nfat5 UTSW 8 107367223 nonsense probably null
R4627:Nfat5 UTSW 8 107369276 missense probably damaging 1.00
R4917:Nfat5 UTSW 8 107324652 missense probably damaging 1.00
R4918:Nfat5 UTSW 8 107324652 missense probably damaging 1.00
R5089:Nfat5 UTSW 8 107351438 missense probably damaging 1.00
R5495:Nfat5 UTSW 8 107368447 missense probably benign 0.03
R5566:Nfat5 UTSW 8 107369135 missense possibly damaging 0.47
R5851:Nfat5 UTSW 8 107347727 missense probably damaging 1.00
R6012:Nfat5 UTSW 8 107367133 missense probably benign 0.09
R6018:Nfat5 UTSW 8 107355651 critical splice donor site probably null
R6364:Nfat5 UTSW 8 107368277 missense probably benign 0.00
R6404:Nfat5 UTSW 8 107370588 missense probably benign 0.01
R7056:Nfat5 UTSW 8 107368106 missense probably damaging 1.00
R7105:Nfat5 UTSW 8 107369191 missense possibly damaging 0.88
R7128:Nfat5 UTSW 8 107358691 missense probably benign 0.10
R7214:Nfat5 UTSW 8 107293883 missense probably damaging 0.99
R7276:Nfat5 UTSW 8 107367099 missense probably benign 0.25
R7560:Nfat5 UTSW 8 107370589 missense probably benign 0.15
R7844:Nfat5 UTSW 8 107358668 missense probably damaging 1.00
R7927:Nfat5 UTSW 8 107358668 missense probably damaging 1.00
X0022:Nfat5 UTSW 8 107347756 nonsense probably null
Z1177:Nfat5 UTSW 8 107338842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCAGATTCCCTGGAACAGTA -3'
(R):5'- CTCCATGTCAATTTCAGCTTCTG -3'

Sequencing Primer
(F):5'- GTTTGTGAACTGCTATGTGG -3'
(R):5'- CATGGAACACTCTTTACCAC -3'
Posted On2018-11-02