Incidental Mutation 'R6892:Rapgef1'
ID538089
Institutional Source Beutler Lab
Gene Symbol Rapgef1
Ensembl Gene ENSMUSG00000039844
Gene NameRap guanine nucleotide exchange factor (GEF) 1
SynonymsGrf2, 4932418O06Rik, C3G
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6892 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location29619720-29740978 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 29699840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091146] [ENSMUST00000095087] [ENSMUST00000102872] [ENSMUST00000147755]
Predicted Effect probably null
Transcript: ENSMUST00000091146
SMART Domains Protein: ENSMUSP00000088680
Gene: ENSMUSG00000039844

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 689 700 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
RasGEFN 828 970 8.04e-37 SMART
RasGEF 977 1206 5.85e-102 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095087
SMART Domains Protein: ENSMUSP00000092703
Gene: ENSMUSG00000039844

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 702 720 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
RasGEFN 834 976 8.04e-37 SMART
RasGEF 983 1212 5.85e-102 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102872
SMART Domains Protein: ENSMUSP00000099936
Gene: ENSMUSG00000039844

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
RasGEFN 696 838 8.04e-37 SMART
RasGEF 845 1074 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147488
SMART Domains Protein: ENSMUSP00000117631
Gene: ENSMUSG00000039844

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
RasGEFN 253 395 8.04e-37 SMART
RasGEF 402 631 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147755
SMART Domains Protein: ENSMUSP00000121615
Gene: ENSMUSG00000039844

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
low complexity region 663 681 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before E7.5. Mice homozygous for a hypomorphic gene trap allele show embryonic lethality during organogenesis, altered neuroepithelium morphology, vascular maturation defects, hemorrhage, and reduced cell migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,354 L193P probably damaging Het
4930442H23Rik C A 10: 81,183,144 probably benign Het
4933421I07Rik T C 7: 42,446,407 Q139R probably benign Het
A930002H24Rik C T 17: 63,863,764 V10M unknown Het
Acvr2a T A 2: 48,897,075 L394Q probably damaging Het
Ano6 T C 15: 95,967,624 Y830H probably damaging Het
Atp8b4 T A 2: 126,343,002 I914F possibly damaging Het
Cab39 A G 1: 85,848,377 D265G probably damaging Het
Capn5 A T 7: 98,135,941 W109R probably damaging Het
Cdk18 G T 1: 132,122,110 T44K probably benign Het
Cdt1 T A 8: 122,570,212 N248K probably damaging Het
Cpa4 G T 6: 30,583,629 R248L probably benign Het
Cpt1a G A 19: 3,371,660 V481M probably benign Het
Cyp3a11 G A 5: 145,860,448 L374F probably damaging Het
Dcdc2a A G 13: 25,056,460 N64D probably damaging Het
Dmxl1 G A 18: 49,920,902 R2525Q probably damaging Het
Dscaml1 G A 9: 45,683,830 V744M probably damaging Het
Dync1h1 G A 12: 110,638,901 E2391K probably benign Het
Ezh1 A T 11: 101,199,361 Y522* probably null Het
Fzd3 G C 14: 65,209,881 A533G possibly damaging Het
Gm14403 T G 2: 177,509,247 C329G probably damaging Het
Gm17067 A C 7: 42,710,675 probably null Het
Gm38119 A G 3: 92,738,222 C22R unknown Het
Gtf3c3 A G 1: 54,415,941 S588P probably benign Het
Ift140 A G 17: 25,020,546 E59G possibly damaging Het
Ints1 A T 5: 139,767,828 M683K probably damaging Het
Iws1 A G 18: 32,086,274 M470V probably damaging Het
Mptx1 A G 1: 174,332,265 R46G probably benign Het
Nhsl1 C T 10: 18,524,343 T439I probably damaging Het
Olfr517 A G 7: 108,868,515 L213P probably damaging Het
Peg3 C T 7: 6,708,899 S1108N possibly damaging Het
Pgm2 A G 4: 99,929,708 E48G probably benign Het
Pkhd1 G A 1: 20,523,515 T1458I probably damaging Het
Polr1a A T 6: 71,964,712 D1068V possibly damaging Het
Ptprq T C 10: 107,576,004 T1834A probably benign Het
Rgl1 A T 1: 152,539,940 D409E probably benign Het
Rgsl1 G T 1: 153,821,499 Y558* probably null Het
Rock1 C T 18: 10,122,612 R403H probably benign Het
Scn11a T A 9: 119,806,969 D304V possibly damaging Het
Sdk1 A T 5: 142,046,298 I1043F probably benign Het
Sgms2 A G 3: 131,342,154 Y24H probably benign Het
Sppl2a A G 2: 126,913,575 I372T probably damaging Het
Sptbn1 A G 11: 30,142,187 M526T probably benign Het
Stxbp5l A T 16: 37,188,629 S683T possibly damaging Het
Syk A T 13: 52,632,898 R332S probably benign Het
Syne2 T A 12: 75,962,528 V2401E probably damaging Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tbc1d22b A G 17: 29,595,890 K378E possibly damaging Het
Tcte1 A G 17: 45,533,157 T20A probably benign Het
Tor1aip2 A T 1: 156,065,181 Y411F possibly damaging Het
Trim43c T A 9: 88,844,924 M267K probably benign Het
Ubr2 T G 17: 46,934,108 Y1664S probably damaging Het
Uhrf1bp1l G A 10: 89,805,123 V719I probably benign Het
Vmn1r41 C A 6: 89,747,181 Q235K possibly damaging Het
Wdr17 T C 8: 54,673,596 T401A probably damaging Het
Zfp454 A G 11: 50,873,198 L469P probably damaging Het
Other mutations in Rapgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Rapgef1 APN 2 29722269 missense probably benign
IGL00917:Rapgef1 APN 2 29702523 missense probably benign 0.00
IGL02618:Rapgef1 APN 2 29737943 missense probably damaging 1.00
IGL02642:Rapgef1 APN 2 29700860 splice site probably benign
IGL02974:Rapgef1 APN 2 29710216 missense possibly damaging 0.64
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0279:Rapgef1 UTSW 2 29726227 missense probably damaging 1.00
R0432:Rapgef1 UTSW 2 29679816 missense possibly damaging 0.86
R1817:Rapgef1 UTSW 2 29686256 missense probably damaging 1.00
R1837:Rapgef1 UTSW 2 29737426 missense probably damaging 1.00
R1970:Rapgef1 UTSW 2 29733711 missense probably damaging 1.00
R1980:Rapgef1 UTSW 2 29722227 missense probably benign
R2076:Rapgef1 UTSW 2 29702508 missense probably benign 0.00
R2363:Rapgef1 UTSW 2 29736596 missense possibly damaging 0.63
R3016:Rapgef1 UTSW 2 29707393 missense probably damaging 1.00
R3053:Rapgef1 UTSW 2 29724856 missense probably damaging 1.00
R3777:Rapgef1 UTSW 2 29719689 missense possibly damaging 0.67
R3980:Rapgef1 UTSW 2 29719650 missense probably benign 0.33
R4491:Rapgef1 UTSW 2 29719656 missense possibly damaging 0.93
R4524:Rapgef1 UTSW 2 29679246 missense probably benign 0.00
R4732:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R4733:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R5391:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5395:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5611:Rapgef1 UTSW 2 29702436 missense probably damaging 0.96
R6062:Rapgef1 UTSW 2 29700732 missense probably damaging 0.96
R6145:Rapgef1 UTSW 2 29736666 missense probably damaging 1.00
R6580:Rapgef1 UTSW 2 29730609 missense possibly damaging 0.95
R6897:Rapgef1 UTSW 2 29702502 missense probably damaging 1.00
R6957:Rapgef1 UTSW 2 29733698 missense possibly damaging 0.62
R7039:Rapgef1 UTSW 2 29726214 missense probably damaging 0.97
R7149:Rapgef1 UTSW 2 29720700 missense probably damaging 0.98
R7253:Rapgef1 UTSW 2 29699721 missense possibly damaging 0.72
R7315:Rapgef1 UTSW 2 29734492 missense probably damaging 0.98
R7956:Rapgef1 UTSW 2 29699015 missense probably benign 0.03
R8161:Rapgef1 UTSW 2 29679198 missense probably benign 0.08
R8162:Rapgef1 UTSW 2 29735999 missense probably damaging 0.99
R8372:Rapgef1 UTSW 2 29710231 missense probably damaging 0.99
R8373:Rapgef1 UTSW 2 29710231 missense probably damaging 0.99
RF005:Rapgef1 UTSW 2 29707195 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTACGCGTGATCCCTAGTTC -3'
(R):5'- TGCCAATCACTCTATCAATGCC -3'

Sequencing Primer
(F):5'- ACGCGTGATCCCTAGTTCTTTCC -3'
(R):5'- GAACCAAAACAGATTCTTTTCCTTCC -3'
Posted On2018-11-06