Incidental Mutation 'R6892:Sppl2a'
ID538092
Institutional Source Beutler Lab
Gene Symbol Sppl2a
Ensembl Gene ENSMUSG00000027366
Gene Namesignal peptide peptidase like 2A
SynonymsC130089K23Rik, 2010106G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6892 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location126890391-126933235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126913575 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 372 (I372T)
Ref Sequence ENSEMBL: ENSMUSP00000028844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028844]
Predicted Effect probably damaging
Transcript: ENSMUST00000028844
AA Change: I372T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028844
Gene: ENSMUSG00000027366
AA Change: I372T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:PA 58 153 1.7e-12 PFAM
transmembrane domain 173 195 N/A INTRINSIC
PSN 218 486 3.65e-102 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119064
Gene: ENSMUSG00000027366
AA Change: I100T

DomainStartEndE-ValueType
PSN 3 233 1.27e-60 SMART
Meta Mutation Damage Score 0.8011 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases, which are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions, as well as a member of the signal peptide peptidase-like protease (SPPL) family. This protein is expressed in all major adult human tissues and localizes to late endosomal compartments and lysosomal membranes. A pseudogene of this gene also lies on chromosome 15. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased immunoglobulin prior to and after immunization and decreased splenic B cells, myeloid dendritic cells, T2 B cells and follicular B cells. Mice homozygous for a hypomorphic allele exhibit similar albeit less severe phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,354 L193P probably damaging Het
4930442H23Rik C A 10: 81,183,144 probably benign Het
4933421I07Rik T C 7: 42,446,407 Q139R probably benign Het
A930002H24Rik C T 17: 63,863,764 V10M unknown Het
Acvr2a T A 2: 48,897,075 L394Q probably damaging Het
Ano6 T C 15: 95,967,624 Y830H probably damaging Het
Atp8b4 T A 2: 126,343,002 I914F possibly damaging Het
Cab39 A G 1: 85,848,377 D265G probably damaging Het
Capn5 A T 7: 98,135,941 W109R probably damaging Het
Cdk18 G T 1: 132,122,110 T44K probably benign Het
Cdt1 T A 8: 122,570,212 N248K probably damaging Het
Cpa4 G T 6: 30,583,629 R248L probably benign Het
Cpt1a G A 19: 3,371,660 V481M probably benign Het
Cyp3a11 G A 5: 145,860,448 L374F probably damaging Het
Dcdc2a A G 13: 25,056,460 N64D probably damaging Het
Dmxl1 G A 18: 49,920,902 R2525Q probably damaging Het
Dscaml1 G A 9: 45,683,830 V744M probably damaging Het
Dync1h1 G A 12: 110,638,901 E2391K probably benign Het
Ezh1 A T 11: 101,199,361 Y522* probably null Het
Fzd3 G C 14: 65,209,881 A533G possibly damaging Het
Gm14403 T G 2: 177,509,247 C329G probably damaging Het
Gm17067 A C 7: 42,710,675 probably null Het
Gm38119 A G 3: 92,738,222 C22R unknown Het
Gtf3c3 A G 1: 54,415,941 S588P probably benign Het
Ift140 A G 17: 25,020,546 E59G possibly damaging Het
Ints1 A T 5: 139,767,828 M683K probably damaging Het
Iws1 A G 18: 32,086,274 M470V probably damaging Het
Mptx1 A G 1: 174,332,265 R46G probably benign Het
Nhsl1 C T 10: 18,524,343 T439I probably damaging Het
Olfr517 A G 7: 108,868,515 L213P probably damaging Het
Peg3 C T 7: 6,708,899 S1108N possibly damaging Het
Pgm2 A G 4: 99,929,708 E48G probably benign Het
Pkhd1 G A 1: 20,523,515 T1458I probably damaging Het
Polr1a A T 6: 71,964,712 D1068V possibly damaging Het
Ptprq T C 10: 107,576,004 T1834A probably benign Het
Rapgef1 T C 2: 29,699,840 probably null Het
Rgl1 A T 1: 152,539,940 D409E probably benign Het
Rgsl1 G T 1: 153,821,499 Y558* probably null Het
Rock1 C T 18: 10,122,612 R403H probably benign Het
Scn11a T A 9: 119,806,969 D304V possibly damaging Het
Sdk1 A T 5: 142,046,298 I1043F probably benign Het
Sgms2 A G 3: 131,342,154 Y24H probably benign Het
Sptbn1 A G 11: 30,142,187 M526T probably benign Het
Stxbp5l A T 16: 37,188,629 S683T possibly damaging Het
Syk A T 13: 52,632,898 R332S probably benign Het
Syne2 T A 12: 75,962,528 V2401E probably damaging Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tbc1d22b A G 17: 29,595,890 K378E possibly damaging Het
Tcte1 A G 17: 45,533,157 T20A probably benign Het
Tor1aip2 A T 1: 156,065,181 Y411F possibly damaging Het
Trim43c T A 9: 88,844,924 M267K probably benign Het
Ubr2 T G 17: 46,934,108 Y1664S probably damaging Het
Uhrf1bp1l G A 10: 89,805,123 V719I probably benign Het
Vmn1r41 C A 6: 89,747,181 Q235K possibly damaging Het
Wdr17 T C 8: 54,673,596 T401A probably damaging Het
Zfp454 A G 11: 50,873,198 L469P probably damaging Het
Other mutations in Sppl2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Sppl2a APN 2 126919720 missense probably benign 0.04
IGL01471:Sppl2a APN 2 126917867 nonsense probably null
IGL01572:Sppl2a APN 2 126920312 splice site probably null
IGL01712:Sppl2a APN 2 126904903 splice site probably benign
IGL02203:Sppl2a APN 2 126904941 missense possibly damaging 0.68
IGL02572:Sppl2a APN 2 126926296 missense probably benign 0.07
abra UTSW 2 126923594 missense probably benign 0.00
abra2 UTSW 2 126920313 splice site probably null
isaac UTSW 2 126913575 missense probably damaging 1.00
jacob UTSW 2 126913281 splice site probably null
PIT4431001:Sppl2a UTSW 2 126923476 missense probably damaging 1.00
R0023:Sppl2a UTSW 2 126913293 splice site probably null
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0458:Sppl2a UTSW 2 126904959 missense probably damaging 1.00
R0627:Sppl2a UTSW 2 126920417 unclassified probably benign
R0799:Sppl2a UTSW 2 126920307 splice site probably benign
R1029:Sppl2a UTSW 2 126923594 missense probably benign 0.00
R1245:Sppl2a UTSW 2 126913521 splice site probably benign
R1669:Sppl2a UTSW 2 126917794 splice site probably benign
R2047:Sppl2a UTSW 2 126926852 missense probably damaging 1.00
R2215:Sppl2a UTSW 2 126927834 missense probably benign 0.00
R2428:Sppl2a UTSW 2 126912695 missense possibly damaging 0.93
R3522:Sppl2a UTSW 2 126920322 missense possibly damaging 0.66
R4653:Sppl2a UTSW 2 126920313 splice site probably null
R5398:Sppl2a UTSW 2 126919718 missense probably benign 0.00
R6382:Sppl2a UTSW 2 126917029 splice site probably null
R6888:Sppl2a UTSW 2 126904992 missense probably damaging 0.99
R7021:Sppl2a UTSW 2 126927743 splice site probably null
R7750:Sppl2a UTSW 2 126919705 missense probably damaging 1.00
R8129:Sppl2a UTSW 2 126923470 missense probably damaging 1.00
R8136:Sppl2a UTSW 2 126913281 splice site probably null
R8772:Sppl2a UTSW 2 126926311 missense probably benign 0.16
RF016:Sppl2a UTSW 2 126927774 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATTCTAGGATGAAACCCAAGTC -3'
(R):5'- CTCCAGTGAAGTGAAGTGGTG -3'

Sequencing Primer
(F):5'- TCTAGGATGAAACCCAAGTCAATAG -3'
(R):5'- CAGTGAAGTGAAGTGGTGTGCTATC -3'
Posted On2018-11-06