Incidental Mutation 'R6892:Pgm2'
ID538096
Institutional Source Beutler Lab
Gene Symbol Pgm2
Ensembl Gene ENSMUSG00000025791
Gene Namephosphoglucomutase 2
Synonyms2610020G18Rik, Pgm-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R6892 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location99929414-99987294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99929708 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 48 (E48G)
Ref Sequence ENSEMBL: ENSMUSP00000061227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058351]
Predicted Effect probably benign
Transcript: ENSMUST00000058351
AA Change: E48G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061227
Gene: ENSMUSG00000025791
AA Change: E48G

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 14 158 1.7e-42 PFAM
Pfam:PGM_PMM_II 193 301 3.3e-20 PFAM
Pfam:PGM_PMM_III 306 420 1.1e-33 PFAM
Pfam:PGM_PMM_IV 436 543 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,354 L193P probably damaging Het
4930442H23Rik C A 10: 81,183,144 probably benign Het
4933421I07Rik T C 7: 42,446,407 Q139R probably benign Het
A930002H24Rik C T 17: 63,863,764 V10M unknown Het
Acvr2a T A 2: 48,897,075 L394Q probably damaging Het
Ano6 T C 15: 95,967,624 Y830H probably damaging Het
Atp8b4 T A 2: 126,343,002 I914F possibly damaging Het
Cab39 A G 1: 85,848,377 D265G probably damaging Het
Capn5 A T 7: 98,135,941 W109R probably damaging Het
Cdk18 G T 1: 132,122,110 T44K probably benign Het
Cdt1 T A 8: 122,570,212 N248K probably damaging Het
Cpa4 G T 6: 30,583,629 R248L probably benign Het
Cpt1a G A 19: 3,371,660 V481M probably benign Het
Cyp3a11 G A 5: 145,860,448 L374F probably damaging Het
Dcdc2a A G 13: 25,056,460 N64D probably damaging Het
Dmxl1 G A 18: 49,920,902 R2525Q probably damaging Het
Dscaml1 G A 9: 45,683,830 V744M probably damaging Het
Dync1h1 G A 12: 110,638,901 E2391K probably benign Het
Ezh1 A T 11: 101,199,361 Y522* probably null Het
Fzd3 G C 14: 65,209,881 A533G possibly damaging Het
Gm14403 T G 2: 177,509,247 C329G probably damaging Het
Gm17067 A C 7: 42,710,675 probably null Het
Gm38119 A G 3: 92,738,222 C22R unknown Het
Gtf3c3 A G 1: 54,415,941 S588P probably benign Het
Ift140 A G 17: 25,020,546 E59G possibly damaging Het
Ints1 A T 5: 139,767,828 M683K probably damaging Het
Iws1 A G 18: 32,086,274 M470V probably damaging Het
Mptx1 A G 1: 174,332,265 R46G probably benign Het
Nhsl1 C T 10: 18,524,343 T439I probably damaging Het
Olfr517 A G 7: 108,868,515 L213P probably damaging Het
Peg3 C T 7: 6,708,899 S1108N possibly damaging Het
Pkhd1 G A 1: 20,523,515 T1458I probably damaging Het
Polr1a A T 6: 71,964,712 D1068V possibly damaging Het
Ptprq T C 10: 107,576,004 T1834A probably benign Het
Rapgef1 T C 2: 29,699,840 probably null Het
Rgl1 A T 1: 152,539,940 D409E probably benign Het
Rgsl1 G T 1: 153,821,499 Y558* probably null Het
Rock1 C T 18: 10,122,612 R403H probably benign Het
Scn11a T A 9: 119,806,969 D304V possibly damaging Het
Sdk1 A T 5: 142,046,298 I1043F probably benign Het
Sgms2 A G 3: 131,342,154 Y24H probably benign Het
Sppl2a A G 2: 126,913,575 I372T probably damaging Het
Sptbn1 A G 11: 30,142,187 M526T probably benign Het
Stxbp5l A T 16: 37,188,629 S683T possibly damaging Het
Syk A T 13: 52,632,898 R332S probably benign Het
Syne2 T A 12: 75,962,528 V2401E probably damaging Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tbc1d22b A G 17: 29,595,890 K378E possibly damaging Het
Tcte1 A G 17: 45,533,157 T20A probably benign Het
Tor1aip2 A T 1: 156,065,181 Y411F possibly damaging Het
Trim43c T A 9: 88,844,924 M267K probably benign Het
Ubr2 T G 17: 46,934,108 Y1664S probably damaging Het
Uhrf1bp1l G A 10: 89,805,123 V719I probably benign Het
Vmn1r41 C A 6: 89,747,181 Q235K possibly damaging Het
Wdr17 T C 8: 54,673,596 T401A probably damaging Het
Zfp454 A G 11: 50,873,198 L469P probably damaging Het
Other mutations in Pgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Pgm2 APN 4 99929606 missense probably damaging 1.00
IGL01468:Pgm2 APN 4 99962170 missense possibly damaging 0.82
IGL02013:Pgm2 APN 4 99983961 splice site probably benign
IGL02237:Pgm2 APN 4 99963510 splice site probably benign
IGL02945:Pgm2 APN 4 99961534 missense probably benign
IGL03201:Pgm2 APN 4 99970039 missense probably damaging 0.99
IGL03373:Pgm2 APN 4 99961544 missense probably damaging 1.00
R0349:Pgm2 UTSW 4 99963617 missense probably damaging 1.00
R0683:Pgm2 UTSW 4 99961543 missense probably damaging 0.99
R1650:Pgm2 UTSW 4 99962070 missense possibly damaging 0.70
R1650:Pgm2 UTSW 4 99962079 missense probably benign 0.28
R1741:Pgm2 UTSW 4 99964865 splice site probably null
R1759:Pgm2 UTSW 4 99967108 missense probably damaging 1.00
R1843:Pgm2 UTSW 4 99961478 missense probably damaging 1.00
R3111:Pgm2 UTSW 4 99956025 missense probably benign
R4115:Pgm2 UTSW 4 99962151 nonsense probably null
R4426:Pgm2 UTSW 4 99962140 missense probably benign 0.04
R4748:Pgm2 UTSW 4 99981979 missense probably benign 0.24
R4910:Pgm2 UTSW 4 99963527 missense probably damaging 1.00
R4920:Pgm2 UTSW 4 99986733 missense probably damaging 1.00
R5289:Pgm2 UTSW 4 99967069 missense probably damaging 1.00
R5764:Pgm2 UTSW 4 99964846 missense probably damaging 1.00
R6199:Pgm2 UTSW 4 99978954 missense probably damaging 1.00
R6311:Pgm2 UTSW 4 99970040 missense possibly damaging 0.93
R6600:Pgm2 UTSW 4 99967062 nonsense probably null
R6818:Pgm2 UTSW 4 99963566 missense probably damaging 1.00
R6984:Pgm2 UTSW 4 99929654 missense probably benign 0.04
R7429:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R7430:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R8017:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8019:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8143:Pgm2 UTSW 4 99967218 splice site probably null
R8724:Pgm2 UTSW 4 99929767 missense probably benign 0.00
R8893:Pgm2 UTSW 4 99967100 missense probably damaging 0.99
RF018:Pgm2 UTSW 4 99962303 splice site probably null
Z1176:Pgm2 UTSW 4 99978997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCAGGGCAAGAGCAGAG -3'
(R):5'- GCATAGCCATTGCGAAACG -3'

Sequencing Primer
(F):5'- TCTGCAGCAGCCAGAGC -3'
(R):5'- CCATTGCGAAACGTGGGGTG -3'
Posted On2018-11-06