Incidental Mutation 'R6892:Capn5'
ID 538107
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Name calpain 5
Synonyms
MMRRC Submission 044986-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6892 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 97770766-97827481 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 97785148 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 109 (W109R)
Ref Sequence ENSEMBL: ENSMUSP00000102729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112]
AlphaFold O08688
Predicted Effect probably damaging
Transcript: ENSMUST00000040971
AA Change: W109R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: W109R

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107112
AA Change: W109R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: W109R

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930442H23Rik C A 10: 81,018,978 (GRCm39) probably benign Het
4933421I07Rik T C 7: 42,095,831 (GRCm39) Q139R probably benign Het
A930002H24Rik C T 17: 64,170,759 (GRCm39) V10M unknown Het
Acvr2a T A 2: 48,787,087 (GRCm39) L394Q probably damaging Het
Ano6 T C 15: 95,865,505 (GRCm39) Y830H probably damaging Het
Atp8b4 T A 2: 126,184,922 (GRCm39) I914F possibly damaging Het
Bltp3b G A 10: 89,640,985 (GRCm39) V719I probably benign Het
Cab39 A G 1: 85,776,098 (GRCm39) D265G probably damaging Het
Cdk18 G T 1: 132,049,848 (GRCm39) T44K probably benign Het
Cdt1 T A 8: 123,296,951 (GRCm39) N248K probably damaging Het
Cpa4 G T 6: 30,583,628 (GRCm39) R248L probably benign Het
Cpt1a G A 19: 3,421,660 (GRCm39) V481M probably benign Het
Cyp3a11 G A 5: 145,797,258 (GRCm39) L374F probably damaging Het
Dcdc2a A G 13: 25,240,443 (GRCm39) N64D probably damaging Het
Dmxl1 G A 18: 50,053,969 (GRCm39) R2525Q probably damaging Het
Dscaml1 G A 9: 45,595,128 (GRCm39) V744M probably damaging Het
Dync1h1 G A 12: 110,605,335 (GRCm39) E2391K probably benign Het
Ezh1 A T 11: 101,090,187 (GRCm39) Y522* probably null Het
Fzd3 G C 14: 65,447,330 (GRCm39) A533G possibly damaging Het
Gm14403 T G 2: 177,201,040 (GRCm39) C329G probably damaging Het
Gm17067 A C 7: 42,360,099 (GRCm39) probably null Het
Gm38119 A G 3: 92,645,529 (GRCm39) C22R unknown Het
Grep1 A G 17: 23,931,328 (GRCm39) L193P probably damaging Het
Gtf3c3 A G 1: 54,455,100 (GRCm39) S588P probably benign Het
Ift140 A G 17: 25,239,520 (GRCm39) E59G possibly damaging Het
Ints1 A T 5: 139,753,583 (GRCm39) M683K probably damaging Het
Iws1 A G 18: 32,219,327 (GRCm39) M470V probably damaging Het
Mptx1 A G 1: 174,159,831 (GRCm39) R46G probably benign Het
Nhsl1 C T 10: 18,400,091 (GRCm39) T439I probably damaging Het
Or10a49 A G 7: 108,467,722 (GRCm39) L213P probably damaging Het
Peg3 C T 7: 6,711,898 (GRCm39) S1108N possibly damaging Het
Pgm1 A G 4: 99,786,905 (GRCm39) E48G probably benign Het
Pkhd1 G A 1: 20,593,739 (GRCm39) T1458I probably damaging Het
Polr1a A T 6: 71,941,696 (GRCm39) D1068V possibly damaging Het
Ptprq T C 10: 107,411,865 (GRCm39) T1834A probably benign Het
Rapgef1 T C 2: 29,589,852 (GRCm39) probably null Het
Rgl1 A T 1: 152,415,691 (GRCm39) D409E probably benign Het
Rgsl1 G T 1: 153,697,245 (GRCm39) Y558* probably null Het
Rock1 C T 18: 10,122,612 (GRCm39) R403H probably benign Het
Scn11a T A 9: 119,636,035 (GRCm39) D304V possibly damaging Het
Sdk1 A T 5: 142,032,053 (GRCm39) I1043F probably benign Het
Sgms2 A G 3: 131,135,803 (GRCm39) Y24H probably benign Het
Sppl2a A G 2: 126,755,495 (GRCm39) I372T probably damaging Het
Sptbn1 A G 11: 30,092,187 (GRCm39) M526T probably benign Het
Stxbp5l A T 16: 37,008,991 (GRCm39) S683T possibly damaging Het
Syk A T 13: 52,786,934 (GRCm39) R332S probably benign Het
Syne2 T A 12: 76,009,302 (GRCm39) V2401E probably damaging Het
Tarm1 T C 7: 3,546,006 (GRCm39) Y87C probably damaging Het
Tbc1d22b A G 17: 29,814,864 (GRCm39) K378E possibly damaging Het
Tcte1 A G 17: 45,844,083 (GRCm39) T20A probably benign Het
Tor1aip2 A T 1: 155,940,927 (GRCm39) Y411F possibly damaging Het
Trim43c T A 9: 88,726,977 (GRCm39) M267K probably benign Het
Ubr2 T G 17: 47,245,034 (GRCm39) Y1664S probably damaging Het
Vmn1r41 C A 6: 89,724,163 (GRCm39) Q235K possibly damaging Het
Wdr17 T C 8: 55,126,631 (GRCm39) T401A probably damaging Het
Zfp454 A G 11: 50,764,025 (GRCm39) L469P probably damaging Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 97,784,971 (GRCm39) missense probably damaging 1.00
IGL01311:Capn5 APN 7 97,811,130 (GRCm39) missense probably damaging 1.00
IGL01768:Capn5 APN 7 97,774,480 (GRCm39) missense probably damaging 1.00
IGL01926:Capn5 APN 7 97,777,679 (GRCm39) critical splice donor site probably null
IGL02076:Capn5 APN 7 97,780,950 (GRCm39) nonsense probably null
IGL02505:Capn5 APN 7 97,780,403 (GRCm39) missense possibly damaging 0.85
BB007:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
BB017:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
PIT4466001:Capn5 UTSW 7 97,773,195 (GRCm39) missense probably benign 0.00
R0178:Capn5 UTSW 7 97,782,098 (GRCm39) missense probably damaging 1.00
R0518:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R0521:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R1459:Capn5 UTSW 7 97,781,049 (GRCm39) missense possibly damaging 0.84
R2005:Capn5 UTSW 7 97,778,570 (GRCm39) missense probably benign
R2258:Capn5 UTSW 7 97,785,082 (GRCm39) missense probably damaging 0.99
R2327:Capn5 UTSW 7 97,775,574 (GRCm39) missense probably benign 0.07
R3797:Capn5 UTSW 7 97,775,036 (GRCm39) missense probably null 0.77
R4032:Capn5 UTSW 7 97,778,453 (GRCm39) missense probably damaging 0.96
R4620:Capn5 UTSW 7 97,778,578 (GRCm39) missense probably damaging 0.98
R4717:Capn5 UTSW 7 97,773,126 (GRCm39) missense probably benign 0.02
R4777:Capn5 UTSW 7 97,780,925 (GRCm39) missense probably damaging 1.00
R4823:Capn5 UTSW 7 97,775,648 (GRCm39) missense probably damaging 1.00
R4841:Capn5 UTSW 7 97,780,879 (GRCm39) splice site probably null
R4965:Capn5 UTSW 7 97,775,624 (GRCm39) missense probably damaging 0.99
R5568:Capn5 UTSW 7 97,775,137 (GRCm39) missense probably damaging 1.00
R5732:Capn5 UTSW 7 97,778,593 (GRCm39) missense possibly damaging 0.95
R5792:Capn5 UTSW 7 97,780,402 (GRCm39) missense probably benign 0.09
R6923:Capn5 UTSW 7 97,778,461 (GRCm39) missense probably damaging 1.00
R7095:Capn5 UTSW 7 97,775,038 (GRCm39) missense probably benign 0.10
R7391:Capn5 UTSW 7 97,780,426 (GRCm39) missense probably benign 0.02
R7553:Capn5 UTSW 7 97,773,231 (GRCm39) missense probably damaging 1.00
R7930:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
R8876:Capn5 UTSW 7 97,780,902 (GRCm39) missense probably benign 0.01
R8914:Capn5 UTSW 7 97,784,997 (GRCm39) missense probably damaging 0.99
R9012:Capn5 UTSW 7 97,814,050 (GRCm39) start gained probably benign
R9087:Capn5 UTSW 7 97,775,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCAGACAGCTCCACCTG -3'
(R):5'- TAAGACCAGACTGTTCACCAGG -3'

Sequencing Primer
(F):5'- GCACCTACTTGGCATAGGC -3'
(R):5'- TGTTCACCAGGTCCCACAGTG -3'
Posted On 2018-11-06