Mutagenetix > Incidental Mutations

Incidental Mutation 'R6892:Scn11a'

538113

Institutional Source

Beutler Lab

Gene Symbol

Scn11a

Ensembl Gene

ENSMUSG00000034115

Gene Name

sodium channel, voltage-gated, type XI, alpha

Synonyms

NaN, NSS2, NaT, SNS2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R6892 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119753759-119825456 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119806969 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 304 (D304V)

Ref Sequence

ENSEMBL: ENSMUSP00000149420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070617
AA Change: D304V

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: D304V

Domain	Start	End	E-Value	Type
low complexity region	27	43	N/A	INTRINSIC
Pfam:Ion_trans	128	409	1.1e-72	PFAM
low complexity region	475	487	N/A	INTRINSIC
Pfam:Ion_trans	574	810	4e-57	PFAM
Pfam:Na_trans_assoc	814	1030	4.1e-29	PFAM
Pfam:Ion_trans	1034	1300	5.7e-66	PFAM
Pfam:Ion_trans	1346	1595	3e-58	PFAM
low complexity region	1683	1694	N/A	INTRINSIC
low complexity region	1733	1744	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215718
AA Change: D304V

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.6%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	A	G	17: 23,712,354	L193P	probably damaging	Het
4930442H23Rik	C	A	10: 81,183,144		probably benign	Het
4933421I07Rik	T	C	7: 42,446,407	Q139R	probably benign	Het
A930002H24Rik	C	T	17: 63,863,764	V10M	unknown	Het
Acvr2a	T	A	2: 48,897,075	L394Q	probably damaging	Het
Ano6	T	C	15: 95,967,624	Y830H	probably damaging	Het
Atp8b4	T	A	2: 126,343,002	I914F	possibly damaging	Het
Cab39	A	G	1: 85,848,377	D265G	probably damaging	Het
Capn5	A	T	7: 98,135,941	W109R	probably damaging	Het
Cdk18	G	T	1: 132,122,110	T44K	probably benign	Het
Cdt1	T	A	8: 122,570,212	N248K	probably damaging	Het
Cpa4	G	T	6: 30,583,629	R248L	probably benign	Het
Cpt1a	G	A	19: 3,371,660	V481M	probably benign	Het
Cyp3a11	G	A	5: 145,860,448	L374F	probably damaging	Het
Dcdc2a	A	G	13: 25,056,460	N64D	probably damaging	Het
Dmxl1	G	A	18: 49,920,902	R2525Q	probably damaging	Het
Dscaml1	G	A	9: 45,683,830	V744M	probably damaging	Het
Dync1h1	G	A	12: 110,638,901	E2391K	probably benign	Het
Ezh1	A	T	11: 101,199,361	Y522*	probably null	Het
Fzd3	G	C	14: 65,209,881	A533G	possibly damaging	Het
Gm14403	T	G	2: 177,509,247	C329G	probably damaging	Het
Gm17067	A	C	7: 42,710,675		probably null	Het
Gm38119	A	G	3: 92,738,222	C22R	unknown	Het
Gtf3c3	A	G	1: 54,415,941	S588P	probably benign	Het
Ift140	A	G	17: 25,020,546	E59G	possibly damaging	Het
Ints1	A	T	5: 139,767,828	M683K	probably damaging	Het
Iws1	A	G	18: 32,086,274	M470V	probably damaging	Het
Mptx1	A	G	1: 174,332,265	R46G	probably benign	Het
Nhsl1	C	T	10: 18,524,343	T439I	probably damaging	Het
Olfr517	A	G	7: 108,868,515	L213P	probably damaging	Het
Peg3	C	T	7: 6,708,899	S1108N	possibly damaging	Het
Pgm2	A	G	4: 99,929,708	E48G	probably benign	Het
Pkhd1	G	A	1: 20,523,515	T1458I	probably damaging	Het
Polr1a	A	T	6: 71,964,712	D1068V	possibly damaging	Het
Ptprq	T	C	10: 107,576,004	T1834A	probably benign	Het
Rapgef1	T	C	2: 29,699,840		probably null	Het
Rgl1	A	T	1: 152,539,940	D409E	probably benign	Het
Rgsl1	G	T	1: 153,821,499	Y558*	probably null	Het
Rock1	C	T	18: 10,122,612	R403H	probably benign	Het
Sdk1	A	T	5: 142,046,298	I1043F	probably benign	Het
Sgms2	A	G	3: 131,342,154	Y24H	probably benign	Het
Sppl2a	A	G	2: 126,913,575	I372T	probably damaging	Het
Sptbn1	A	G	11: 30,142,187	M526T	probably benign	Het
Stxbp5l	A	T	16: 37,188,629	S683T	possibly damaging	Het
Syk	A	T	13: 52,632,898	R332S	probably benign	Het
Syne2	T	A	12: 75,962,528	V2401E	probably damaging	Het
Tarm1	T	C	7: 3,497,490	Y87C	probably damaging	Het
Tbc1d22b	A	G	17: 29,595,890	K378E	possibly damaging	Het
Tcte1	A	G	17: 45,533,157	T20A	probably benign	Het
Tor1aip2	A	T	1: 156,065,181	Y411F	possibly damaging	Het
Trim43c	T	A	9: 88,844,924	M267K	probably benign	Het
Ubr2	T	G	17: 46,934,108	Y1664S	probably damaging	Het
Uhrf1bp1l	G	A	10: 89,805,123	V719I	probably benign	Het
Vmn1r41	C	A	6: 89,747,181	Q235K	possibly damaging	Het
Wdr17	T	C	8: 54,673,596	T401A	probably damaging	Het
Zfp454	A	G	11: 50,873,198	L469P	probably damaging	Het

Other mutations in Scn11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Scn11a	APN	9	119770506	missense	probably benign	0.00
IGL00272:Scn11a	APN	9	119816603	missense	probably damaging	0.98
IGL00332:Scn11a	APN	9	119769916	missense	probably damaging	1.00
IGL00533:Scn11a	APN	9	119774381	missense	probably damaging	1.00
IGL00972:Scn11a	APN	9	119793938	missense	probably benign	0.44
IGL01338:Scn11a	APN	9	119784161	splice site	probably benign
IGL01534:Scn11a	APN	9	119780822	missense	probably benign	0.27
IGL01838:Scn11a	APN	9	119758583	missense	probably damaging	1.00
IGL01991:Scn11a	APN	9	119819904	missense	probably damaging	0.97
IGL02057:Scn11a	APN	9	119765470	missense	probably damaging	1.00
IGL02290:Scn11a	APN	9	119774442	missense	probably damaging	0.97
IGL02454:Scn11a	APN	9	119758544	missense	probably benign	0.00
IGL02517:Scn11a	APN	9	119792398	missense	probably damaging	1.00
IGL02567:Scn11a	APN	9	119804489	missense	probably damaging	0.99
IGL02587:Scn11a	APN	9	119805684	missense	probably damaging	1.00
IGL03069:Scn11a	APN	9	119789963	missense	probably benign	0.16
IGL03171:Scn11a	APN	9	119819847	missense	probably benign	0.00
Kleinie	UTSW	9	119803503	missense	probably benign	0.16
H8441:Scn11a	UTSW	9	119807910	missense	probably damaging	1.00
PIT4449001:Scn11a	UTSW	9	119769948	missense	probably damaging	1.00
R0304:Scn11a	UTSW	9	119819862	missense	probably benign	0.00
R0519:Scn11a	UTSW	9	119790119	missense	probably damaging	1.00
R0658:Scn11a	UTSW	9	119811160	missense	probably benign	0.41
R0828:Scn11a	UTSW	9	119755007	missense	probably benign	0.00
R0893:Scn11a	UTSW	9	119803330	splice site	probably null
R0932:Scn11a	UTSW	9	119807810	missense	probably damaging	1.00
R1061:Scn11a	UTSW	9	119795663	missense	probably damaging	0.98
R1161:Scn11a	UTSW	9	119755057	nonsense	probably null
R1162:Scn11a	UTSW	9	119805644	splice site	probably benign
R1310:Scn11a	UTSW	9	119755057	nonsense	probably null
R1589:Scn11a	UTSW	9	119769807	missense	probably damaging	1.00
R1681:Scn11a	UTSW	9	119804412	missense	possibly damaging	0.46
R1781:Scn11a	UTSW	9	119755082	missense	probably damaging	1.00
R1812:Scn11a	UTSW	9	119780865	nonsense	probably null
R1901:Scn11a	UTSW	9	119779036	nonsense	probably null
R1978:Scn11a	UTSW	9	119780795	nonsense	probably null
R1985:Scn11a	UTSW	9	119754678	missense	probably benign	0.19
R2022:Scn11a	UTSW	9	119811208	missense	possibly damaging	0.88
R2072:Scn11a	UTSW	9	119811208	missense	possibly damaging	0.88
R2098:Scn11a	UTSW	9	119792494	missense	possibly damaging	0.67
R2163:Scn11a	UTSW	9	119755025	missense	probably damaging	1.00
R2250:Scn11a	UTSW	9	119758602	missense	probably benign	0.01
R2373:Scn11a	UTSW	9	119813186	missense	probably benign	0.43
R2508:Scn11a	UTSW	9	119765529	missense	probably damaging	1.00
R3757:Scn11a	UTSW	9	119803503	missense	probably benign	0.16
R3767:Scn11a	UTSW	9	119784049	missense	probably damaging	1.00
R3770:Scn11a	UTSW	9	119784049	missense	probably damaging	1.00
R4089:Scn11a	UTSW	9	119795653	splice site	probably null
R4092:Scn11a	UTSW	9	119789970	missense	probably benign	0.03
R4247:Scn11a	UTSW	9	119807886	missense	probably damaging	1.00
R4279:Scn11a	UTSW	9	119754362	missense	probably benign	0.25
R4299:Scn11a	UTSW	9	119765506	missense	probably damaging	0.97
R4403:Scn11a	UTSW	9	119795667	missense	probably damaging	1.00
R4468:Scn11a	UTSW	9	119754987	missense	probably damaging	1.00
R4542:Scn11a	UTSW	9	119755134	missense	probably damaging	1.00
R4644:Scn11a	UTSW	9	119815203	splice site	probably null
R4739:Scn11a	UTSW	9	119754561	missense	probably benign	0.39
R4809:Scn11a	UTSW	9	119819870	missense	probably benign	0.00
R4954:Scn11a	UTSW	9	119758659	missense	possibly damaging	0.84
R5012:Scn11a	UTSW	9	119780878	missense	probably benign	0.31
R5044:Scn11a	UTSW	9	119819831	missense	probably damaging	0.98
R5222:Scn11a	UTSW	9	119815202	splice site	probably null
R5224:Scn11a	UTSW	9	119754792	missense	probably damaging	1.00
R5400:Scn11a	UTSW	9	119769908	missense	probably damaging	0.97
R5555:Scn11a	UTSW	9	119755238	missense	probably damaging	1.00
R5711:Scn11a	UTSW	9	119789924	missense	probably damaging	1.00
R5950:Scn11a	UTSW	9	119811124	missense	probably damaging	1.00
R5984:Scn11a	UTSW	9	119784016	missense	probably benign
R6057:Scn11a	UTSW	9	119765448	missense	probably damaging	1.00
R6104:Scn11a	UTSW	9	119795678	missense	probably damaging	1.00
R6180:Scn11a	UTSW	9	119754867	missense	probably benign	0.00
R6908:Scn11a	UTSW	9	119792426	missense	probably damaging	1.00
R6949:Scn11a	UTSW	9	119765514	missense	probably benign	0.04
R7112:Scn11a	UTSW	9	119754809	missense	probably damaging	1.00
R7232:Scn11a	UTSW	9	119759916	missense	probably damaging	1.00
R7261:Scn11a	UTSW	9	119819833	missense	probably damaging	0.99
R7265:Scn11a	UTSW	9	119815265	missense	probably damaging	1.00
R7302:Scn11a	UTSW	9	119806951	missense	probably benign	0.03
R7391:Scn11a	UTSW	9	119795717	missense	probably damaging	1.00
R7441:Scn11a	UTSW	9	119758626	missense	probably benign	0.01
R7479:Scn11a	UTSW	9	119759875	missense	probably benign	0.38
R7608:Scn11a	UTSW	9	119815313	splice site	probably null
R7768:Scn11a	UTSW	9	119815272	missense	probably benign	0.13
R7785:Scn11a	UTSW	9	119816556	missense	probably benign	0.00
R7794:Scn11a	UTSW	9	119765514	missense	probably damaging	0.99
R7818:Scn11a	UTSW	9	119784111	missense	probably damaging	0.97
R7884:Scn11a	UTSW	9	119804551	missense	probably benign	0.01
R7988:Scn11a	UTSW	9	119765437	missense	probably damaging	0.97
R8049:Scn11a	UTSW	9	119755083	missense	probably damaging	1.00
R8127:Scn11a	UTSW	9	119804512	missense	probably damaging	1.00
R8274:Scn11a	UTSW	9	119803482	missense	probably benign
R8344:Scn11a	UTSW	9	119781970	missense	probably benign	0.00
R8346:Scn11a	UTSW	9	119778981	missense	probably damaging	1.00
R8511:Scn11a	UTSW	9	119789915	missense	probably damaging	0.99
Z1088:Scn11a	UTSW	9	119755242	missense	probably damaging	1.00
Z1177:Scn11a	UTSW	9	119754998	missense	possibly damaging	0.94
Z1177:Scn11a	UTSW	9	119819820	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTTAAAAGCAAAAGTTAGGAGCC -3'
(R):5'- TGAGGCTCCATTCCTTGATGG -3'

Sequencing Primer
(F):5'- TGCATGCACATGGTACTCAG -3'
(R):5'- GATGCTCATGTTGATCACTTCAGAG -3'

Posted On

2018-11-06