Incidental Mutation 'R6892:Sptbn1'
ID538118
Institutional Source Beutler Lab
Gene Symbol Sptbn1
Ensembl Gene ENSMUSG00000020315
Gene Namespectrin beta, non-erythrocytic 1
Synonymsnon-erythrocytic, Spnb-2, elf3, 9930031C03Rik, elf1, beta fodrin, brain spectrin, spectrin G, Spnb2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6892 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location30099395-30268175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30142187 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 526 (M526T)
Ref Sequence ENSEMBL: ENSMUSP00000114841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]
Predicted Effect probably benign
Transcript: ENSMUST00000006629
AA Change: M526T

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: M526T

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000011877
AA Change: M526T

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: M526T

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102838
AA Change: M513T

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: M513T

DomainStartEndE-ValueType
CH 43 143 3.02e-28 SMART
CH 162 260 8.73e-25 SMART
SPEC 292 398 2.03e0 SMART
SPEC 412 512 6.42e-26 SMART
SPEC 518 622 4.61e-27 SMART
SPEC 628 728 2.36e-33 SMART
SPEC 734 833 1.2e-25 SMART
SPEC 839 939 7.16e-24 SMART
SPEC 945 1046 6.58e-23 SMART
SPEC 1052 1153 1.79e-24 SMART
SPEC 1159 1259 2.2e-24 SMART
SPEC 1265 1364 5.18e-21 SMART
SPEC 1370 1469 1.02e-19 SMART
SPEC 1475 1576 7.2e-29 SMART
SPEC 1582 1682 8.03e-27 SMART
SPEC 1688 1789 9.73e-26 SMART
SPEC 1795 1895 9.82e-22 SMART
SPEC 1901 2001 8.68e-23 SMART
SPEC 2007 2114 2.66e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124231
AA Change: M526T

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: M526T

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2092 6.42e-2 SMART
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,354 L193P probably damaging Het
4930442H23Rik C A 10: 81,183,144 probably benign Het
4933421I07Rik T C 7: 42,446,407 Q139R probably benign Het
A930002H24Rik C T 17: 63,863,764 V10M unknown Het
Acvr2a T A 2: 48,897,075 L394Q probably damaging Het
Ano6 T C 15: 95,967,624 Y830H probably damaging Het
Atp8b4 T A 2: 126,343,002 I914F possibly damaging Het
Cab39 A G 1: 85,848,377 D265G probably damaging Het
Capn5 A T 7: 98,135,941 W109R probably damaging Het
Cdk18 G T 1: 132,122,110 T44K probably benign Het
Cdt1 T A 8: 122,570,212 N248K probably damaging Het
Cpa4 G T 6: 30,583,629 R248L probably benign Het
Cpt1a G A 19: 3,371,660 V481M probably benign Het
Cyp3a11 G A 5: 145,860,448 L374F probably damaging Het
Dcdc2a A G 13: 25,056,460 N64D probably damaging Het
Dmxl1 G A 18: 49,920,902 R2525Q probably damaging Het
Dscaml1 G A 9: 45,683,830 V744M probably damaging Het
Dync1h1 G A 12: 110,638,901 E2391K probably benign Het
Ezh1 A T 11: 101,199,361 Y522* probably null Het
Fzd3 G C 14: 65,209,881 A533G possibly damaging Het
Gm14403 T G 2: 177,509,247 C329G probably damaging Het
Gm17067 A C 7: 42,710,675 probably null Het
Gm38119 A G 3: 92,738,222 C22R unknown Het
Gtf3c3 A G 1: 54,415,941 S588P probably benign Het
Ift140 A G 17: 25,020,546 E59G possibly damaging Het
Ints1 A T 5: 139,767,828 M683K probably damaging Het
Iws1 A G 18: 32,086,274 M470V probably damaging Het
Mptx1 A G 1: 174,332,265 R46G probably benign Het
Nhsl1 C T 10: 18,524,343 T439I probably damaging Het
Olfr517 A G 7: 108,868,515 L213P probably damaging Het
Peg3 C T 7: 6,708,899 S1108N possibly damaging Het
Pgm2 A G 4: 99,929,708 E48G probably benign Het
Pkhd1 G A 1: 20,523,515 T1458I probably damaging Het
Polr1a A T 6: 71,964,712 D1068V possibly damaging Het
Ptprq T C 10: 107,576,004 T1834A probably benign Het
Rapgef1 T C 2: 29,699,840 probably null Het
Rgl1 A T 1: 152,539,940 D409E probably benign Het
Rgsl1 G T 1: 153,821,499 Y558* probably null Het
Rock1 C T 18: 10,122,612 R403H probably benign Het
Scn11a T A 9: 119,806,969 D304V possibly damaging Het
Sdk1 A T 5: 142,046,298 I1043F probably benign Het
Sgms2 A G 3: 131,342,154 Y24H probably benign Het
Sppl2a A G 2: 126,913,575 I372T probably damaging Het
Stxbp5l A T 16: 37,188,629 S683T possibly damaging Het
Syk A T 13: 52,632,898 R332S probably benign Het
Syne2 T A 12: 75,962,528 V2401E probably damaging Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tbc1d22b A G 17: 29,595,890 K378E possibly damaging Het
Tcte1 A G 17: 45,533,157 T20A probably benign Het
Tor1aip2 A T 1: 156,065,181 Y411F possibly damaging Het
Trim43c T A 9: 88,844,924 M267K probably benign Het
Ubr2 T G 17: 46,934,108 Y1664S probably damaging Het
Uhrf1bp1l G A 10: 89,805,123 V719I probably benign Het
Vmn1r41 C A 6: 89,747,181 Q235K possibly damaging Het
Wdr17 T C 8: 54,673,596 T401A probably damaging Het
Zfp454 A G 11: 50,873,198 L469P probably damaging Het
Other mutations in Sptbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sptbn1 APN 11 30110818 nonsense probably null
IGL01098:Sptbn1 APN 11 30159385 missense probably damaging 1.00
IGL01843:Sptbn1 APN 11 30104623 missense probably benign 0.02
IGL02070:Sptbn1 APN 11 30145979 missense probably damaging 0.99
IGL02075:Sptbn1 APN 11 30138496 missense probably damaging 1.00
IGL02094:Sptbn1 APN 11 30100659 missense probably benign 0.01
IGL02102:Sptbn1 APN 11 30137427 missense probably damaging 1.00
IGL02189:Sptbn1 APN 11 30117871 missense probably damaging 1.00
IGL02256:Sptbn1 APN 11 30120990 missense probably benign 0.24
IGL02301:Sptbn1 APN 11 30142129 missense probably damaging 1.00
IGL02354:Sptbn1 APN 11 30110783 missense probably damaging 1.00
IGL02361:Sptbn1 APN 11 30110783 missense probably damaging 1.00
IGL02377:Sptbn1 APN 11 30119491 missense possibly damaging 0.92
IGL02504:Sptbn1 APN 11 30142293 missense probably damaging 1.00
IGL02672:Sptbn1 APN 11 30137239 missense probably damaging 1.00
IGL02733:Sptbn1 APN 11 30197747 missense probably benign 0.12
IGL02755:Sptbn1 APN 11 30142247 missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30123855 missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30123855 missense probably damaging 1.00
R0096:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0139:Sptbn1 UTSW 11 30142289 missense probably benign 0.00
R0370:Sptbn1 UTSW 11 30121545 missense probably benign
R0389:Sptbn1 UTSW 11 30139250 missense possibly damaging 0.95
R0415:Sptbn1 UTSW 11 30149576 missense probably damaging 1.00
R0552:Sptbn1 UTSW 11 30145985 missense possibly damaging 0.92
R0601:Sptbn1 UTSW 11 30150008 missense probably damaging 1.00
R0609:Sptbn1 UTSW 11 30138979 missense probably damaging 1.00
R0675:Sptbn1 UTSW 11 30117903 missense probably damaging 1.00
R0708:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0711:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0729:Sptbn1 UTSW 11 30110902 missense probably damaging 0.96
R0755:Sptbn1 UTSW 11 30139016 missense probably damaging 1.00
R0892:Sptbn1 UTSW 11 30142201 missense probably damaging 1.00
R0927:Sptbn1 UTSW 11 30121591 missense probably damaging 1.00
R1102:Sptbn1 UTSW 11 30120785 missense possibly damaging 0.93
R1460:Sptbn1 UTSW 11 30138637 missense possibly damaging 0.50
R1479:Sptbn1 UTSW 11 30113909 missense probably damaging 1.00
R1496:Sptbn1 UTSW 11 30121498 missense probably damaging 1.00
R1649:Sptbn1 UTSW 11 30137301 missense probably damaging 0.97
R1663:Sptbn1 UTSW 11 30120783 missense possibly damaging 0.53
R1671:Sptbn1 UTSW 11 30142245 missense possibly damaging 0.57
R1680:Sptbn1 UTSW 11 30159371 missense possibly damaging 0.92
R1695:Sptbn1 UTSW 11 30136124 missense probably benign 0.13
R1868:Sptbn1 UTSW 11 30114781 missense possibly damaging 0.70
R1918:Sptbn1 UTSW 11 30142414 missense probably damaging 1.00
R1921:Sptbn1 UTSW 11 30104469 missense probably damaging 0.98
R2026:Sptbn1 UTSW 11 30104559 missense probably benign 0.02
R2038:Sptbn1 UTSW 11 30159293 critical splice donor site probably null
R2047:Sptbn1 UTSW 11 30138360 splice site probably benign
R2312:Sptbn1 UTSW 11 30154249 missense probably damaging 1.00
R3430:Sptbn1 UTSW 11 30219686 missense possibly damaging 0.67
R3624:Sptbn1 UTSW 11 30140593 missense probably damaging 1.00
R3723:Sptbn1 UTSW 11 30137335 missense possibly damaging 0.59
R3862:Sptbn1 UTSW 11 30142329 missense possibly damaging 0.63
R4446:Sptbn1 UTSW 11 30139114 missense possibly damaging 0.70
R4582:Sptbn1 UTSW 11 30219597 missense probably damaging 1.00
R4705:Sptbn1 UTSW 11 30100660 missense probably benign
R4707:Sptbn1 UTSW 11 30137197 missense possibly damaging 0.61
R4718:Sptbn1 UTSW 11 30154297 missense probably damaging 1.00
R4789:Sptbn1 UTSW 11 30117759 missense probably benign
R4824:Sptbn1 UTSW 11 30118295 missense possibly damaging 0.72
R4855:Sptbn1 UTSW 11 30142353 missense probably damaging 1.00
R5009:Sptbn1 UTSW 11 30124016 missense probably benign 0.05
R5071:Sptbn1 UTSW 11 30113854 critical splice donor site probably null
R5153:Sptbn1 UTSW 11 30121510 missense possibly damaging 0.82
R5334:Sptbn1 UTSW 11 30137364 missense possibly damaging 0.92
R5462:Sptbn1 UTSW 11 30100520 missense possibly damaging 0.94
R5523:Sptbn1 UTSW 11 30137560 missense probably damaging 1.00
R5707:Sptbn1 UTSW 11 30143174 missense possibly damaging 0.65
R5724:Sptbn1 UTSW 11 30144113 missense possibly damaging 0.91
R5738:Sptbn1 UTSW 11 30145941 missense probably damaging 1.00
R5864:Sptbn1 UTSW 11 30145925 missense probably damaging 1.00
R5895:Sptbn1 UTSW 11 30123978 missense probably damaging 0.99
R5932:Sptbn1 UTSW 11 30136136 missense probably damaging 1.00
R5966:Sptbn1 UTSW 11 30124873 missense probably damaging 1.00
R5984:Sptbn1 UTSW 11 30118464 missense probably damaging 1.00
R6155:Sptbn1 UTSW 11 30137403 missense probably damaging 0.99
R6163:Sptbn1 UTSW 11 30159443 nonsense probably null
R6226:Sptbn1 UTSW 11 30136054 missense probably damaging 1.00
R6271:Sptbn1 UTSW 11 30100660 missense probably benign 0.00
R6443:Sptbn1 UTSW 11 30139429 missense possibly damaging 0.56
R6591:Sptbn1 UTSW 11 30113984 missense probably damaging 0.99
R6616:Sptbn1 UTSW 11 30124030 missense probably benign 0.08
R6691:Sptbn1 UTSW 11 30113984 missense probably damaging 0.99
R6751:Sptbn1 UTSW 11 30117859 missense probably damaging 1.00
R6823:Sptbn1 UTSW 11 30114787 missense probably damaging 1.00
R6863:Sptbn1 UTSW 11 30146777 missense possibly damaging 0.94
R6885:Sptbn1 UTSW 11 30138634 missense probably benign 0.26
R6998:Sptbn1 UTSW 11 30100633 missense probably damaging 0.97
R7043:Sptbn1 UTSW 11 30103323 missense probably benign 0.02
R7092:Sptbn1 UTSW 11 30137119 missense possibly damaging 0.75
R7272:Sptbn1 UTSW 11 30114859 missense possibly damaging 0.93
R7301:Sptbn1 UTSW 11 30117798 nonsense probably null
R7379:Sptbn1 UTSW 11 30139292 missense possibly damaging 0.72
R7774:Sptbn1 UTSW 11 30142142 missense probably damaging 0.99
R7813:Sptbn1 UTSW 11 30138455 missense probably damaging 1.00
R7837:Sptbn1 UTSW 11 30138832 missense probably damaging 1.00
R7843:Sptbn1 UTSW 11 30154320 missense probably damaging 1.00
R7846:Sptbn1 UTSW 11 30142153 missense probably damaging 0.98
R7877:Sptbn1 UTSW 11 30129601 missense possibly damaging 0.94
R7902:Sptbn1 UTSW 11 30136048 missense probably damaging 1.00
R7920:Sptbn1 UTSW 11 30138832 missense probably damaging 1.00
R7926:Sptbn1 UTSW 11 30154320 missense probably damaging 1.00
R7929:Sptbn1 UTSW 11 30142153 missense probably damaging 0.98
R7960:Sptbn1 UTSW 11 30129601 missense possibly damaging 0.94
R7985:Sptbn1 UTSW 11 30136048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAGAAGAGTTCACTGGAC -3'
(R):5'- ATTTGACCTTCCCGCTGTTGAG -3'

Sequencing Primer
(F):5'- GTTCACTGGACAAAGAGCACTAGC -3'
(R):5'- GCCATTGAGACAGACATCGCTG -3'
Posted On2018-11-06