Incidental Mutation 'R6892:Stxbp5l'
ID 538127
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Name syntaxin binding protein 5-like
Synonyms insulin level locus 1, T2dm1, LLGL4, tomosyn-2, t2md1, A830015P08Rik
MMRRC Submission 044986-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6892 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 36935304-37205324 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37008991 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 683 (S683T)
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
AlphaFold Q5DQR4
Predicted Effect possibly damaging
Transcript: ENSMUST00000114780
AA Change: S683T

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829
AA Change: S683T

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000114781
AA Change: S683T

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829
AA Change: S683T

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114782
AA Change: S683T

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829
AA Change: S683T

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000114787
AA Change: S683T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829
AA Change: S683T

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930442H23Rik C A 10: 81,018,978 (GRCm39) probably benign Het
4933421I07Rik T C 7: 42,095,831 (GRCm39) Q139R probably benign Het
A930002H24Rik C T 17: 64,170,759 (GRCm39) V10M unknown Het
Acvr2a T A 2: 48,787,087 (GRCm39) L394Q probably damaging Het
Ano6 T C 15: 95,865,505 (GRCm39) Y830H probably damaging Het
Atp8b4 T A 2: 126,184,922 (GRCm39) I914F possibly damaging Het
Bltp3b G A 10: 89,640,985 (GRCm39) V719I probably benign Het
Cab39 A G 1: 85,776,098 (GRCm39) D265G probably damaging Het
Capn5 A T 7: 97,785,148 (GRCm39) W109R probably damaging Het
Cdk18 G T 1: 132,049,848 (GRCm39) T44K probably benign Het
Cdt1 T A 8: 123,296,951 (GRCm39) N248K probably damaging Het
Cpa4 G T 6: 30,583,628 (GRCm39) R248L probably benign Het
Cpt1a G A 19: 3,421,660 (GRCm39) V481M probably benign Het
Cyp3a11 G A 5: 145,797,258 (GRCm39) L374F probably damaging Het
Dcdc2a A G 13: 25,240,443 (GRCm39) N64D probably damaging Het
Dmxl1 G A 18: 50,053,969 (GRCm39) R2525Q probably damaging Het
Dscaml1 G A 9: 45,595,128 (GRCm39) V744M probably damaging Het
Dync1h1 G A 12: 110,605,335 (GRCm39) E2391K probably benign Het
Ezh1 A T 11: 101,090,187 (GRCm39) Y522* probably null Het
Fzd3 G C 14: 65,447,330 (GRCm39) A533G possibly damaging Het
Gm14403 T G 2: 177,201,040 (GRCm39) C329G probably damaging Het
Gm17067 A C 7: 42,360,099 (GRCm39) probably null Het
Gm38119 A G 3: 92,645,529 (GRCm39) C22R unknown Het
Grep1 A G 17: 23,931,328 (GRCm39) L193P probably damaging Het
Gtf3c3 A G 1: 54,455,100 (GRCm39) S588P probably benign Het
Ift140 A G 17: 25,239,520 (GRCm39) E59G possibly damaging Het
Ints1 A T 5: 139,753,583 (GRCm39) M683K probably damaging Het
Iws1 A G 18: 32,219,327 (GRCm39) M470V probably damaging Het
Mptx1 A G 1: 174,159,831 (GRCm39) R46G probably benign Het
Nhsl1 C T 10: 18,400,091 (GRCm39) T439I probably damaging Het
Or10a49 A G 7: 108,467,722 (GRCm39) L213P probably damaging Het
Peg3 C T 7: 6,711,898 (GRCm39) S1108N possibly damaging Het
Pgm1 A G 4: 99,786,905 (GRCm39) E48G probably benign Het
Pkhd1 G A 1: 20,593,739 (GRCm39) T1458I probably damaging Het
Polr1a A T 6: 71,941,696 (GRCm39) D1068V possibly damaging Het
Ptprq T C 10: 107,411,865 (GRCm39) T1834A probably benign Het
Rapgef1 T C 2: 29,589,852 (GRCm39) probably null Het
Rgl1 A T 1: 152,415,691 (GRCm39) D409E probably benign Het
Rgsl1 G T 1: 153,697,245 (GRCm39) Y558* probably null Het
Rock1 C T 18: 10,122,612 (GRCm39) R403H probably benign Het
Scn11a T A 9: 119,636,035 (GRCm39) D304V possibly damaging Het
Sdk1 A T 5: 142,032,053 (GRCm39) I1043F probably benign Het
Sgms2 A G 3: 131,135,803 (GRCm39) Y24H probably benign Het
Sppl2a A G 2: 126,755,495 (GRCm39) I372T probably damaging Het
Sptbn1 A G 11: 30,092,187 (GRCm39) M526T probably benign Het
Syk A T 13: 52,786,934 (GRCm39) R332S probably benign Het
Syne2 T A 12: 76,009,302 (GRCm39) V2401E probably damaging Het
Tarm1 T C 7: 3,546,006 (GRCm39) Y87C probably damaging Het
Tbc1d22b A G 17: 29,814,864 (GRCm39) K378E possibly damaging Het
Tcte1 A G 17: 45,844,083 (GRCm39) T20A probably benign Het
Tor1aip2 A T 1: 155,940,927 (GRCm39) Y411F possibly damaging Het
Trim43c T A 9: 88,726,977 (GRCm39) M267K probably benign Het
Ubr2 T G 17: 47,245,034 (GRCm39) Y1664S probably damaging Het
Vmn1r41 C A 6: 89,724,163 (GRCm39) Q235K possibly damaging Het
Wdr17 T C 8: 55,126,631 (GRCm39) T401A probably damaging Het
Zfp454 A G 11: 50,764,025 (GRCm39) L469P probably damaging Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37,028,462 (GRCm39) missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37,024,940 (GRCm39) missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37,036,341 (GRCm39) missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37,165,454 (GRCm39) missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37,020,954 (GRCm39) missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37,150,257 (GRCm39) missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37,028,567 (GRCm39) missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37,007,016 (GRCm39) nonsense probably null
IGL03125:Stxbp5l APN 16 37,007,083 (GRCm39) missense probably benign 0.02
R0058:Stxbp5l UTSW 16 36,962,736 (GRCm39) missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37,108,670 (GRCm39) missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37,036,440 (GRCm39) splice site probably benign
R0454:Stxbp5l UTSW 16 36,954,646 (GRCm39) missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 36,950,159 (GRCm39) critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37,028,458 (GRCm39) missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37,024,883 (GRCm39) missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 36,962,794 (GRCm39) missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37,068,231 (GRCm39) critical splice donor site probably null
R1593:Stxbp5l UTSW 16 36,936,414 (GRCm39) missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37,028,473 (GRCm39) missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37,111,289 (GRCm39) critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37,056,637 (GRCm39) missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37,036,398 (GRCm39) missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 36,936,029 (GRCm39) missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37,028,548 (GRCm39) missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2918:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2935:Stxbp5l UTSW 16 36,954,551 (GRCm39) missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3694:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3695:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R4133:Stxbp5l UTSW 16 37,028,481 (GRCm39) missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37,068,242 (GRCm39) missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37,076,246 (GRCm39) missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37,008,996 (GRCm39) missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 36,954,592 (GRCm39) missense probably benign 0.18
R5105:Stxbp5l UTSW 16 36,962,734 (GRCm39) missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37,007,016 (GRCm39) missense probably benign 0.19
R5358:Stxbp5l UTSW 16 36,994,688 (GRCm39) missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 36,950,213 (GRCm39) missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37,028,459 (GRCm39) missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 36,950,177 (GRCm39) missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37,024,810 (GRCm39) missense possibly damaging 0.74
R7369:Stxbp5l UTSW 16 36,954,703 (GRCm39) missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37,143,965 (GRCm39) missense probably damaging 1.00
R7657:Stxbp5l UTSW 16 37,030,534 (GRCm39) missense probably null 0.21
R8171:Stxbp5l UTSW 16 37,028,416 (GRCm39) missense noncoding transcript
R8338:Stxbp5l UTSW 16 36,994,718 (GRCm39) missense probably damaging 1.00
R8732:Stxbp5l UTSW 16 37,061,809 (GRCm39) missense probably benign
R8833:Stxbp5l UTSW 16 37,024,814 (GRCm39) missense probably benign 0.44
R8883:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8898:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8899:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8906:Stxbp5l UTSW 16 37,028,526 (GRCm39) missense probably damaging 1.00
R8918:Stxbp5l UTSW 16 36,954,892 (GRCm39) missense
R8959:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8961:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8989:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R9027:Stxbp5l UTSW 16 37,165,473 (GRCm39) missense probably damaging 1.00
R9044:Stxbp5l UTSW 16 37,024,930 (GRCm39) missense possibly damaging 0.77
R9226:Stxbp5l UTSW 16 37,076,206 (GRCm39) missense probably damaging 0.96
R9284:Stxbp5l UTSW 16 37,028,442 (GRCm39) nonsense probably null
R9351:Stxbp5l UTSW 16 36,936,047 (GRCm39) missense probably damaging 1.00
R9425:Stxbp5l UTSW 16 36,994,706 (GRCm39) missense possibly damaging 0.83
R9545:Stxbp5l UTSW 16 37,028,625 (GRCm39) critical splice acceptor site probably null
R9567:Stxbp5l UTSW 16 37,061,734 (GRCm39) missense probably benign 0.37
R9616:Stxbp5l UTSW 16 37,036,314 (GRCm39) missense probably damaging 1.00
R9781:Stxbp5l UTSW 16 37,165,485 (GRCm39) missense probably benign 0.38
Z1088:Stxbp5l UTSW 16 37,024,851 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTTGAGTCAGTATTAGCATGC -3'
(R):5'- GGGCTTGTTTCCTGACTTTAAAACAC -3'

Sequencing Primer
(F):5'- GCATGCATTTGAATGGCATCACAC -3'
(R):5'- AACACTAATCACTGTCTGATCTCC -3'
Posted On 2018-11-06