Mutagenetix > Incidental Mutations

Incidental Mutation 'R6892:Ift140'

538129

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6892 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25020546 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 59 (E59G)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024983
AA Change: E59G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: E59G

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137386
AA Change: E59G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: E59G

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.6%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	A	G	17: 23,712,354	L193P	probably damaging	Het
4930442H23Rik	C	A	10: 81,183,144		probably benign	Het
4933421I07Rik	T	C	7: 42,446,407	Q139R	probably benign	Het
A930002H24Rik	C	T	17: 63,863,764	V10M	unknown	Het
Acvr2a	T	A	2: 48,897,075	L394Q	probably damaging	Het
Ano6	T	C	15: 95,967,624	Y830H	probably damaging	Het
Atp8b4	T	A	2: 126,343,002	I914F	possibly damaging	Het
Cab39	A	G	1: 85,848,377	D265G	probably damaging	Het
Capn5	A	T	7: 98,135,941	W109R	probably damaging	Het
Cdk18	G	T	1: 132,122,110	T44K	probably benign	Het
Cdt1	T	A	8: 122,570,212	N248K	probably damaging	Het
Cpa4	G	T	6: 30,583,629	R248L	probably benign	Het
Cpt1a	G	A	19: 3,371,660	V481M	probably benign	Het
Cyp3a11	G	A	5: 145,860,448	L374F	probably damaging	Het
Dcdc2a	A	G	13: 25,056,460	N64D	probably damaging	Het
Dmxl1	G	A	18: 49,920,902	R2525Q	probably damaging	Het
Dscaml1	G	A	9: 45,683,830	V744M	probably damaging	Het
Dync1h1	G	A	12: 110,638,901	E2391K	probably benign	Het
Ezh1	A	T	11: 101,199,361	Y522*	probably null	Het
Fzd3	G	C	14: 65,209,881	A533G	possibly damaging	Het
Gm14403	T	G	2: 177,509,247	C329G	probably damaging	Het
Gm17067	A	C	7: 42,710,675		probably null	Het
Gm38119	A	G	3: 92,738,222	C22R	unknown	Het
Gtf3c3	A	G	1: 54,415,941	S588P	probably benign	Het
Ints1	A	T	5: 139,767,828	M683K	probably damaging	Het
Iws1	A	G	18: 32,086,274	M470V	probably damaging	Het
Mptx1	A	G	1: 174,332,265	R46G	probably benign	Het
Nhsl1	C	T	10: 18,524,343	T439I	probably damaging	Het
Olfr517	A	G	7: 108,868,515	L213P	probably damaging	Het
Peg3	C	T	7: 6,708,899	S1108N	possibly damaging	Het
Pgm2	A	G	4: 99,929,708	E48G	probably benign	Het
Pkhd1	G	A	1: 20,523,515	T1458I	probably damaging	Het
Polr1a	A	T	6: 71,964,712	D1068V	possibly damaging	Het
Ptprq	T	C	10: 107,576,004	T1834A	probably benign	Het
Rapgef1	T	C	2: 29,699,840		probably null	Het
Rgl1	A	T	1: 152,539,940	D409E	probably benign	Het
Rgsl1	G	T	1: 153,821,499	Y558*	probably null	Het
Rock1	C	T	18: 10,122,612	R403H	probably benign	Het
Scn11a	T	A	9: 119,806,969	D304V	possibly damaging	Het
Sdk1	A	T	5: 142,046,298	I1043F	probably benign	Het
Sgms2	A	G	3: 131,342,154	Y24H	probably benign	Het
Sppl2a	A	G	2: 126,913,575	I372T	probably damaging	Het
Sptbn1	A	G	11: 30,142,187	M526T	probably benign	Het
Stxbp5l	A	T	16: 37,188,629	S683T	possibly damaging	Het
Syk	A	T	13: 52,632,898	R332S	probably benign	Het
Syne2	T	A	12: 75,962,528	V2401E	probably damaging	Het
Tarm1	T	C	7: 3,497,490	Y87C	probably damaging	Het
Tbc1d22b	A	G	17: 29,595,890	K378E	possibly damaging	Het
Tcte1	A	G	17: 45,533,157	T20A	probably benign	Het
Tor1aip2	A	T	1: 156,065,181	Y411F	possibly damaging	Het
Trim43c	T	A	9: 88,844,924	M267K	probably benign	Het
Ubr2	T	G	17: 46,934,108	Y1664S	probably damaging	Het
Uhrf1bp1l	G	A	10: 89,805,123	V719I	probably benign	Het
Vmn1r41	C	A	6: 89,747,181	Q235K	possibly damaging	Het
Wdr17	T	C	8: 54,673,596	T401A	probably damaging	Het
Zfp454	A	G	11: 50,873,198	L469P	probably damaging	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAGTGACTGTGGAAGATACCC -3'
(R):5'- ATGCATCCTATGTGCACGGTG -3'

Sequencing Primer
(F):5'- TGTGGAAGATACCCATCATTAGCCTC -3'
(R):5'- GGAAATGATACGCTTACCTTATCTCC -3'

Posted On

2018-11-06