Incidental Mutation 'R6892:Ift140'
ID538129
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Nameintraflagellar transport 140
SynonymsTce5, Wdtc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6892 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25016091-25099495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25020546 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 59 (E59G)
Ref Sequence ENSEMBL: ENSMUSP00000116163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024983
AA Change: E59G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: E59G

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000137386
AA Change: E59G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: E59G

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,354 L193P probably damaging Het
4930442H23Rik C A 10: 81,183,144 probably benign Het
4933421I07Rik T C 7: 42,446,407 Q139R probably benign Het
A930002H24Rik C T 17: 63,863,764 V10M unknown Het
Acvr2a T A 2: 48,897,075 L394Q probably damaging Het
Ano6 T C 15: 95,967,624 Y830H probably damaging Het
Atp8b4 T A 2: 126,343,002 I914F possibly damaging Het
Cab39 A G 1: 85,848,377 D265G probably damaging Het
Capn5 A T 7: 98,135,941 W109R probably damaging Het
Cdk18 G T 1: 132,122,110 T44K probably benign Het
Cdt1 T A 8: 122,570,212 N248K probably damaging Het
Cpa4 G T 6: 30,583,629 R248L probably benign Het
Cpt1a G A 19: 3,371,660 V481M probably benign Het
Cyp3a11 G A 5: 145,860,448 L374F probably damaging Het
Dcdc2a A G 13: 25,056,460 N64D probably damaging Het
Dmxl1 G A 18: 49,920,902 R2525Q probably damaging Het
Dscaml1 G A 9: 45,683,830 V744M probably damaging Het
Dync1h1 G A 12: 110,638,901 E2391K probably benign Het
Ezh1 A T 11: 101,199,361 Y522* probably null Het
Fzd3 G C 14: 65,209,881 A533G possibly damaging Het
Gm14403 T G 2: 177,509,247 C329G probably damaging Het
Gm17067 A C 7: 42,710,675 probably null Het
Gm38119 A G 3: 92,738,222 C22R unknown Het
Gtf3c3 A G 1: 54,415,941 S588P probably benign Het
Ints1 A T 5: 139,767,828 M683K probably damaging Het
Iws1 A G 18: 32,086,274 M470V probably damaging Het
Mptx1 A G 1: 174,332,265 R46G probably benign Het
Nhsl1 C T 10: 18,524,343 T439I probably damaging Het
Olfr517 A G 7: 108,868,515 L213P probably damaging Het
Peg3 C T 7: 6,708,899 S1108N possibly damaging Het
Pgm2 A G 4: 99,929,708 E48G probably benign Het
Pkhd1 G A 1: 20,523,515 T1458I probably damaging Het
Polr1a A T 6: 71,964,712 D1068V possibly damaging Het
Ptprq T C 10: 107,576,004 T1834A probably benign Het
Rapgef1 T C 2: 29,699,840 probably null Het
Rgl1 A T 1: 152,539,940 D409E probably benign Het
Rgsl1 G T 1: 153,821,499 Y558* probably null Het
Rock1 C T 18: 10,122,612 R403H probably benign Het
Scn11a T A 9: 119,806,969 D304V possibly damaging Het
Sdk1 A T 5: 142,046,298 I1043F probably benign Het
Sgms2 A G 3: 131,342,154 Y24H probably benign Het
Sppl2a A G 2: 126,913,575 I372T probably damaging Het
Sptbn1 A G 11: 30,142,187 M526T probably benign Het
Stxbp5l A T 16: 37,188,629 S683T possibly damaging Het
Syk A T 13: 52,632,898 R332S probably benign Het
Syne2 T A 12: 75,962,528 V2401E probably damaging Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tbc1d22b A G 17: 29,595,890 K378E possibly damaging Het
Tcte1 A G 17: 45,533,157 T20A probably benign Het
Tor1aip2 A T 1: 156,065,181 Y411F possibly damaging Het
Trim43c T A 9: 88,844,924 M267K probably benign Het
Ubr2 T G 17: 46,934,108 Y1664S probably damaging Het
Uhrf1bp1l G A 10: 89,805,123 V719I probably benign Het
Vmn1r41 C A 6: 89,747,181 Q235K possibly damaging Het
Wdr17 T C 8: 54,673,596 T401A probably damaging Het
Zfp454 A G 11: 50,873,198 L469P probably damaging Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 splice site probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
R8105:Ift140 UTSW 17 25036975 missense probably benign 0.01
R8415:Ift140 UTSW 17 25092915 missense probably damaging 0.99
R8437:Ift140 UTSW 17 25094677 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGTGACTGTGGAAGATACCC -3'
(R):5'- ATGCATCCTATGTGCACGGTG -3'

Sequencing Primer
(F):5'- TGTGGAAGATACCCATCATTAGCCTC -3'
(R):5'- GGAAATGATACGCTTACCTTATCTCC -3'
Posted On2018-11-06