Incidental Mutation 'R6892:Tbc1d22b'
ID 538130
Institutional Source Beutler Lab
Gene Symbol Tbc1d22b
Ensembl Gene ENSMUSG00000042203
Gene Name TBC1 domain family, member 22B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R6892 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 29549788-29606895 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29595890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 378 (K378E)
Ref Sequence ENSEMBL: ENSMUSP00000046877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048677]
AlphaFold Q80VE5
Predicted Effect possibly damaging
Transcript: ENSMUST00000048677
AA Change: K378E

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046877
Gene: ENSMUSG00000042203
AA Change: K378E

DomainStartEndE-ValueType
Blast:TBC 23 93 6e-12 BLAST
TBC 207 460 1.25e-56 SMART
Blast:TBC 464 504 4e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,712,354 L193P probably damaging Het
4930442H23Rik C A 10: 81,183,144 probably benign Het
4933421I07Rik T C 7: 42,446,407 Q139R probably benign Het
A930002H24Rik C T 17: 63,863,764 V10M unknown Het
Acvr2a T A 2: 48,897,075 L394Q probably damaging Het
Ano6 T C 15: 95,967,624 Y830H probably damaging Het
Atp8b4 T A 2: 126,343,002 I914F possibly damaging Het
Cab39 A G 1: 85,848,377 D265G probably damaging Het
Capn5 A T 7: 98,135,941 W109R probably damaging Het
Cdk18 G T 1: 132,122,110 T44K probably benign Het
Cdt1 T A 8: 122,570,212 N248K probably damaging Het
Cpa4 G T 6: 30,583,629 R248L probably benign Het
Cpt1a G A 19: 3,371,660 V481M probably benign Het
Cyp3a11 G A 5: 145,860,448 L374F probably damaging Het
Dcdc2a A G 13: 25,056,460 N64D probably damaging Het
Dmxl1 G A 18: 49,920,902 R2525Q probably damaging Het
Dscaml1 G A 9: 45,683,830 V744M probably damaging Het
Dync1h1 G A 12: 110,638,901 E2391K probably benign Het
Ezh1 A T 11: 101,199,361 Y522* probably null Het
Fzd3 G C 14: 65,209,881 A533G possibly damaging Het
Gm14403 T G 2: 177,509,247 C329G probably damaging Het
Gm17067 A C 7: 42,710,675 probably null Het
Gm38119 A G 3: 92,738,222 C22R unknown Het
Gtf3c3 A G 1: 54,415,941 S588P probably benign Het
Ift140 A G 17: 25,020,546 E59G possibly damaging Het
Ints1 A T 5: 139,767,828 M683K probably damaging Het
Iws1 A G 18: 32,086,274 M470V probably damaging Het
Mptx1 A G 1: 174,332,265 R46G probably benign Het
Nhsl1 C T 10: 18,524,343 T439I probably damaging Het
Olfr517 A G 7: 108,868,515 L213P probably damaging Het
Peg3 C T 7: 6,708,899 S1108N possibly damaging Het
Pgm2 A G 4: 99,929,708 E48G probably benign Het
Pkhd1 G A 1: 20,523,515 T1458I probably damaging Het
Polr1a A T 6: 71,964,712 D1068V possibly damaging Het
Ptprq T C 10: 107,576,004 T1834A probably benign Het
Rapgef1 T C 2: 29,699,840 probably null Het
Rgl1 A T 1: 152,539,940 D409E probably benign Het
Rgsl1 G T 1: 153,821,499 Y558* probably null Het
Rock1 C T 18: 10,122,612 R403H probably benign Het
Scn11a T A 9: 119,806,969 D304V possibly damaging Het
Sdk1 A T 5: 142,046,298 I1043F probably benign Het
Sgms2 A G 3: 131,342,154 Y24H probably benign Het
Sppl2a A G 2: 126,913,575 I372T probably damaging Het
Sptbn1 A G 11: 30,142,187 M526T probably benign Het
Stxbp5l A T 16: 37,188,629 S683T possibly damaging Het
Syk A T 13: 52,632,898 R332S probably benign Het
Syne2 T A 12: 75,962,528 V2401E probably damaging Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tcte1 A G 17: 45,533,157 T20A probably benign Het
Tor1aip2 A T 1: 156,065,181 Y411F possibly damaging Het
Trim43c T A 9: 88,844,924 M267K probably benign Het
Ubr2 T G 17: 46,934,108 Y1664S probably damaging Het
Uhrf1bp1l G A 10: 89,805,123 V719I probably benign Het
Vmn1r41 C A 6: 89,747,181 Q235K possibly damaging Het
Wdr17 T C 8: 54,673,596 T401A probably damaging Het
Zfp454 A G 11: 50,873,198 L469P probably damaging Het
Other mutations in Tbc1d22b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Tbc1d22b APN 17 29568598 missense possibly damaging 0.60
IGL01836:Tbc1d22b APN 17 29599958 missense probably damaging 1.00
R1524:Tbc1d22b UTSW 17 29570611 missense probably damaging 0.99
R1681:Tbc1d22b UTSW 17 29575177 missense possibly damaging 0.46
R1757:Tbc1d22b UTSW 17 29571673 missense probably damaging 1.00
R2268:Tbc1d22b UTSW 17 29599854 missense probably damaging 1.00
R5656:Tbc1d22b UTSW 17 29594780 missense probably damaging 1.00
R5832:Tbc1d22b UTSW 17 29570647 missense possibly damaging 0.80
R7095:Tbc1d22b UTSW 17 29599869 missense probably damaging 0.96
R7780:Tbc1d22b UTSW 17 29573066 missense probably benign 0.06
R8121:Tbc1d22b UTSW 17 29572971 missense probably damaging 1.00
R8784:Tbc1d22b UTSW 17 29599944 missense probably damaging 1.00
R8964:Tbc1d22b UTSW 17 29600228 missense probably damaging 1.00
R9641:Tbc1d22b UTSW 17 29594773 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGACTGCAGAGATGGCACTG -3'
(R):5'- CTTCCCGCTGAGCTGTGAAG -3'

Sequencing Primer
(F):5'- GAATGATACCTGAAATCTCCGTGGC -3'
(R):5'- CTGTGAAGACAGTGATGCCAAG -3'
Posted On 2018-11-06