Mutagenetix > Incidental Mutations

Incidental Mutation 'R6893:Scn3a'

538141

Institutional Source

Beutler Lab

Gene Symbol

Scn3a

Ensembl Gene

ENSMUSG00000057182

Gene Name

sodium channel, voltage-gated, type III, alpha

Synonyms

Nav1.3, LOC381367

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6893 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65457118-65567627 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65525754 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 212 (V212A)

Ref Sequence

ENSEMBL: ENSMUSP00000097647 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]

AlphaFold

A2ASI5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066432
AA Change: V212A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: V212A

Domain	Start	End	E-Value	Type
low complexity region	23	40	N/A	INTRINSIC
Pfam:Ion_trans	127	435	5.2e-83	PFAM
low complexity region	473	498	N/A	INTRINSIC
Pfam:Na_trans_cytopl	504	626	2e-42	PFAM
Pfam:Ion_trans	710	945	1.4e-58	PFAM
Pfam:Na_trans_assoc	949	1153	2.7e-58	PFAM
Pfam:Ion_trans	1157	1430	3e-67	PFAM
Pfam:Ion_trans	1477	1734	6.3e-55	PFAM
Pfam:PKD_channel	1573	1728	8e-7	PFAM
IQ	1851	1873	5.75e-2	SMART
low complexity region	1913	1921	N/A	INTRINSIC
low complexity region	1927	1943	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100069
AA Change: V212A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: V212A

Domain	Start	End	E-Value	Type
low complexity region	23	40	N/A	INTRINSIC
Pfam:Ion_trans	127	435	5.2e-83	PFAM
low complexity region	473	498	N/A	INTRINSIC
Pfam:Na_trans_cytopl	504	626	2e-42	PFAM
Pfam:Ion_trans	710	945	1.4e-58	PFAM
Pfam:Na_trans_assoc	949	1153	2.7e-58	PFAM
Pfam:Ion_trans	1157	1430	3e-67	PFAM
Pfam:Ion_trans	1477	1734	6.3e-55	PFAM
Pfam:PKD_channel	1573	1728	8e-7	PFAM
IQ	1851	1873	5.75e-2	SMART
low complexity region	1913	1921	N/A	INTRINSIC
low complexity region	1927	1943	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126837

SMART Domains

Protein: ENSMUSP00000115321
Gene: ENSMUSG00000057182

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	122	6.1e-44	PFAM

Meta Mutation Damage Score

0.4282

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.7%
20x: 95.2%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	T	A	8: 24,878,754	D538V	probably damaging	Het
Akap9	T	C	5: 3,961,709	I804T	probably benign	Het
Amy1	T	C	3: 113,563,632	E186G	probably benign	Het
Best1	A	G	19: 9,997,082	Y33H	probably damaging	Het
Cacna1s	C	A	1: 136,077,693	N405K	probably benign	Het
Casp7	T	C	19: 56,433,309	Y60H	probably damaging	Het
Ccdc61	T	C	7: 18,892,563	N367S	possibly damaging	Het
Cnksr3	A	T	10: 7,135,129		probably null	Het
Col14a1	A	C	15: 55,444,648		probably benign	Het
Cyp3a57	A	T	5: 145,386,974	K424*	probably null	Het
Dpep3	T	C	8: 105,973,842	K411E	probably benign	Het
Ebf2	T	A	14: 67,237,559	V81E	probably benign	Het
Ehbp1	G	T	11: 22,014,945	T1084K	probably damaging	Het
Fastkd2	C	T	1: 63,731,794	A103V	possibly damaging	Het
Gm13762	A	G	2: 88,973,799	F31L	probably benign	Het
Gtf3c2	T	C	5: 31,166,378	K525E	probably benign	Het
Hdac2	A	G	10: 36,997,007	E287G	probably damaging	Het
Ifi207	T	A	1: 173,727,642	T832S	possibly damaging	Het
Igf1	G	C	10: 87,864,860	V49L	probably damaging	Het
Lef1	A	G	3: 131,115,500	D55G	possibly damaging	Het
Lipo2	G	T	19: 33,721,007	Y323*	probably null	Het
Mettl24	C	T	10: 40,737,798	R178C	probably damaging	Het
Nat6	A	G	9: 107,583,026	E40G	probably damaging	Het
Ndrg4	C	A	8: 95,706,601	C66*	probably null	Het
Nemf	A	G	12: 69,352,336	V140A	probably benign	Het
Nid2	T	A	14: 19,789,787	F815I	probably benign	Het
Olfr1076	A	G	2: 86,508,792	E111G	probably damaging	Het
Olfr1459	A	C	19: 13,145,742	S306A	probably benign	Het
Olfr876	A	C	9: 37,804,845	*311C	probably null	Het
Olfr918	A	T	9: 38,673,059	N141K	possibly damaging	Het
Pcdhga3	T	C	18: 37,676,545	S684P	probably benign	Het
Plch1	A	T	3: 63,753,141	C352*	probably null	Het
Plscr2	G	A	9: 92,290,704	V139I	probably benign	Het
Ppa1	T	A	10: 61,672,403	C270S	probably benign	Het
Ryr2	T	A	13: 11,829,654	M399L	possibly damaging	Het
Serpina3b	A	G	12: 104,133,026	K267E	probably benign	Het
Shroom3	A	G	5: 92,942,204	T938A	probably damaging	Het
Specc1	A	C	11: 62,132,453	S115R	probably benign	Het
Stim2	C	T	5: 54,053,445	T74I	probably benign	Het
Sult6b2	T	A	6: 142,804,299	D31V	possibly damaging	Het
Tbc1d24	A	T	17: 24,182,518	W406R	probably damaging	Het
Tmprss11b	A	G	5: 86,663,386		probably null	Het
Trappc9	A	G	15: 72,925,650	Y575H	possibly damaging	Het
Trim63	C	T	4: 134,323,101	T232M	probably damaging	Het
Ttn	A	T	2: 76,767,836	S19578T	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr63	T	C	3: 146,080,429	E366G	probably damaging	Het
Xpo4	T	A	14: 57,582,310	E1139D	probably benign	Het

Other mutations in Scn3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00953:Scn3a	APN	2	65497392	missense	probably benign	0.05
IGL01086:Scn3a	APN	2	65470159	missense	probably benign	0.27
IGL01141:Scn3a	APN	2	65495113	missense	possibly damaging	0.73
IGL01150:Scn3a	APN	2	65497365	splice site	probably null
IGL01564:Scn3a	APN	2	65461446	missense	probably damaging	1.00
IGL01594:Scn3a	APN	2	65461431	missense	probably damaging	1.00
IGL01751:Scn3a	APN	2	65461252	missense	possibly damaging	0.87
IGL01803:Scn3a	APN	2	65521783	unclassified	probably benign
IGL01822:Scn3a	APN	2	65495264	missense	probably damaging	1.00
IGL02063:Scn3a	APN	2	65461510	missense	probably damaging	1.00
IGL02142:Scn3a	APN	2	65526621	missense	possibly damaging	0.95
IGL02198:Scn3a	APN	2	65508489	missense	probably benign	0.12
IGL02501:Scn3a	APN	2	65526555	missense	possibly damaging	0.82
IGL02608:Scn3a	APN	2	65524166	nonsense	probably null
IGL02645:Scn3a	APN	2	65514527	missense	probably benign	0.12
IGL02653:Scn3a	APN	2	65461187	missense	probably damaging	1.00
IGL03077:Scn3a	APN	2	65536672	missense	probably damaging	0.99
IGL03099:Scn3a	APN	2	65536672	missense	probably damaging	0.99
IGL03299:Scn3a	APN	2	65497516	missense	probably benign	0.01
IGL03327:Scn3a	APN	2	65536672	missense	probably damaging	0.99
IGL03346:Scn3a	APN	2	65536672	missense	probably damaging	0.99
IGL03355:Scn3a	APN	2	65460568	missense	possibly damaging	0.91
curtsey	UTSW	2	65464836	missense	probably damaging	1.00
dip	UTSW	2	65524179	missense	probably benign	0.01
Regime	UTSW	2	65524850	missense	possibly damaging	0.93
Willpower	UTSW	2	65525754	missense	possibly damaging	0.92
R0019:Scn3a	UTSW	2	65461701	missense	probably damaging	1.00
R0316:Scn3a	UTSW	2	65460829	missense	probably damaging	1.00
R0374:Scn3a	UTSW	2	65508574	missense	probably damaging	0.97
R0414:Scn3a	UTSW	2	65525982	splice site	probably benign
R0609:Scn3a	UTSW	2	65536510	missense	probably damaging	0.96
R0613:Scn3a	UTSW	2	65472284	missense	possibly damaging	0.92
R0645:Scn3a	UTSW	2	65524850	missense	possibly damaging	0.93
R0665:Scn3a	UTSW	2	65484411	missense	probably null	0.00
R0667:Scn3a	UTSW	2	65484411	missense	probably null	0.00
R0710:Scn3a	UTSW	2	65469046	missense	probably damaging	0.99
R1202:Scn3a	UTSW	2	65506147	missense	probably benign	0.07
R1440:Scn3a	UTSW	2	65529441	missense	possibly damaging	0.95
R1447:Scn3a	UTSW	2	65469980	missense	probably damaging	1.00
R1564:Scn3a	UTSW	2	65514635	missense	probably damaging	0.98
R1595:Scn3a	UTSW	2	65498979	missense	probably damaging	0.99
R1775:Scn3a	UTSW	2	65472342	missense	probably damaging	1.00
R1781:Scn3a	UTSW	2	65472385	missense	probably damaging	1.00
R1822:Scn3a	UTSW	2	65484372	missense	probably damaging	1.00
R1924:Scn3a	UTSW	2	65461534	missense	probably damaging	1.00
R2061:Scn3a	UTSW	2	65461308	missense	probably damaging	1.00
R2070:Scn3a	UTSW	2	65520866	missense	possibly damaging	0.72
R2174:Scn3a	UTSW	2	65507206	missense	probably damaging	0.99
R2656:Scn3a	UTSW	2	65526518	missense	probably damaging	0.99
R2680:Scn3a	UTSW	2	65536536	missense	probably benign	0.04
R3882:Scn3a	UTSW	2	65482279	missense	probably benign	0.03
R4019:Scn3a	UTSW	2	65525951	intron	probably benign
R4106:Scn3a	UTSW	2	65495035	missense	probably benign	0.07
R4108:Scn3a	UTSW	2	65495035	missense	probably benign	0.07
R4109:Scn3a	UTSW	2	65495035	missense	probably benign	0.07
R4225:Scn3a	UTSW	2	65536427	missense	probably damaging	0.99
R4419:Scn3a	UTSW	2	65466960	missense	probably damaging	1.00
R4552:Scn3a	UTSW	2	65524179	missense	probably benign	0.01
R4687:Scn3a	UTSW	2	65464730	missense	possibly damaging	0.65
R4780:Scn3a	UTSW	2	65506193	missense	probably damaging	1.00
R4820:Scn3a	UTSW	2	65461278	missense	probably damaging	1.00
R4856:Scn3a	UTSW	2	65461032	missense	probably damaging	1.00
R4886:Scn3a	UTSW	2	65461032	missense	probably damaging	1.00
R4914:Scn3a	UTSW	2	65461455	missense	probably damaging	1.00
R4915:Scn3a	UTSW	2	65461455	missense	probably damaging	1.00
R4918:Scn3a	UTSW	2	65461455	missense	probably damaging	1.00
R5088:Scn3a	UTSW	2	65472299	missense	probably damaging	1.00
R5101:Scn3a	UTSW	2	65461506	missense	probably damaging	1.00
R5128:Scn3a	UTSW	2	65508518	missense	probably benign	0.08
R5132:Scn3a	UTSW	2	65468204	missense	probably benign	0.09
R5297:Scn3a	UTSW	2	65469034	missense	possibly damaging	0.83
R5595:Scn3a	UTSW	2	65460713	missense	probably benign
R5699:Scn3a	UTSW	2	65507264	missense	possibly damaging	0.54
R5730:Scn3a	UTSW	2	65495260	missense	probably benign	0.00
R5735:Scn3a	UTSW	2	65482278	missense	probably damaging	0.98
R5735:Scn3a	UTSW	2	65484459	missense	probably benign	0.09
R5855:Scn3a	UTSW	2	65464730	missense	possibly damaging	0.65
R5888:Scn3a	UTSW	2	65497398	missense	probably benign	0.06
R5898:Scn3a	UTSW	2	65514695	missense	probably damaging	0.96
R5935:Scn3a	UTSW	2	65464836	missense	probably damaging	1.00
R5970:Scn3a	UTSW	2	65494781	intron	probably benign
R6214:Scn3a	UTSW	2	65495036	missense	probably benign	0.29
R6215:Scn3a	UTSW	2	65495036	missense	probably benign	0.29
R6235:Scn3a	UTSW	2	65461335	missense	probably damaging	0.97
R6307:Scn3a	UTSW	2	65472341	missense	probably damaging	1.00
R6355:Scn3a	UTSW	2	65461299	missense	probably damaging	0.99
R6376:Scn3a	UTSW	2	65461499	missense	possibly damaging	0.88
R6517:Scn3a	UTSW	2	65497563	missense	possibly damaging	0.73
R6775:Scn3a	UTSW	2	65521815	missense	possibly damaging	0.82
R6986:Scn3a	UTSW	2	65508618	missense	probably damaging	0.97
R7065:Scn3a	UTSW	2	65464855	missense	probably benign
R7078:Scn3a	UTSW	2	65497600	missense	probably damaging	1.00
R7146:Scn3a	UTSW	2	65483142	missense	probably damaging	1.00
R7240:Scn3a	UTSW	2	65469042	missense	possibly damaging	0.77
R7294:Scn3a	UTSW	2	65472341	missense	probably damaging	1.00
R7352:Scn3a	UTSW	2	65525701	missense	possibly damaging	0.51
R7636:Scn3a	UTSW	2	65497689	missense	probably damaging	1.00
R7708:Scn3a	UTSW	2	65483168	missense	possibly damaging	0.47
R7733:Scn3a	UTSW	2	65508650	missense	probably benign	0.08
R7761:Scn3a	UTSW	2	65529454	missense	possibly damaging	0.95
R7792:Scn3a	UTSW	2	65466990	nonsense	probably null
R7828:Scn3a	UTSW	2	65508574	missense	probably damaging	0.97
R7875:Scn3a	UTSW	2	65497482	missense	probably damaging	1.00
R7884:Scn3a	UTSW	2	65536515	missense	probably damaging	0.96
R7958:Scn3a	UTSW	2	65506193	missense	probably damaging	1.00
R7965:Scn3a	UTSW	2	65506211	missense	probably damaging	1.00
R8171:Scn3a	UTSW	2	65530810	missense	possibly damaging	0.85
R8345:Scn3a	UTSW	2	65498991	missense	possibly damaging	0.86
R8356:Scn3a	UTSW	2	65460673	missense	probably benign	0.08
R8456:Scn3a	UTSW	2	65460673	missense	probably benign	0.08
R8527:Scn3a	UTSW	2	65497519	missense	probably damaging	0.99
R8688:Scn3a	UTSW	2	65525703	missense	possibly damaging	0.92
R8731:Scn3a	UTSW	2	65468163	nonsense	probably null
R8901:Scn3a	UTSW	2	65521908	missense	probably benign	0.00
R8910:Scn3a	UTSW	2	65508539	missense	probably damaging	1.00
R9011:Scn3a	UTSW	2	65521826	missense	possibly damaging	0.71
R9364:Scn3a	UTSW	2	65461252	missense	possibly damaging	0.87
R9460:Scn3a	UTSW	2	65470191	missense	probably damaging	1.00
X0062:Scn3a	UTSW	2	65467001	missense	probably damaging	0.98
X0062:Scn3a	UTSW	2	65524847	nonsense	probably null
Z1177:Scn3a	UTSW	2	65498892	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTTAAAGGAACTGAACCAACAG -3'
(R):5'- AGGCAATGTTTCAGCTCTTCG -3'

Sequencing Primer
(F):5'- AGTGAAACACTGTCTGGTATCTTTG -3'
(R):5'- CGAACTTTCAGAGTCTTGCGAGC -3'

Posted On

2018-11-06